CHAF1B-chromatin assembly factor 1, subunit B (p60) Gene View larger

CHAF1B-chromatin assembly factor 1, subunit B (p60) Gene

PTXBC021218

New product

Data sheet of CHAF1B-chromatin assembly factor 1, subunit B (p60) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CHAF1B-chromatin assembly factor 1, subunit B (p60) Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC021218
Product type: DNA & cDNA
Ncbi symbol: CHAF1B
Origin species: Human
Product name: CHAF1B-chromatin assembly factor 1, subunit B (p60) Gene
Size: 2ug
Accessions: BC021218
Gene id: 8208
Gene description: chromatin assembly factor 1, subunit B (p60)
Synonyms: CAF-1; CAF-IP60; CAF1; CAF1A; CAF1P60; MPHOSPH7; MPP7; chromatin assembly factor 1 subunit B; CAF-1 subunit B; CAF-I 60 kDa subunit; CAF-I p60; M-phase phosphoprotein 7; chromatin assembly factor I p60 subunit; human chromatin assembly factor-I p60 subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaagtcatcacttgtgaaatagcctggcacaacaaggagcccgtgtacagcctggacttccagcatgggacggctgggaggatccacagactggcgtctgccggcgtggacaccaatgtcaggatctggaaggtagaaaagggaccagatggaaaagccatcgtggaatttttgtccaatcttgctcgtcataccaaagccgtcaatgttgtgcgtttttctccaactggggaaattttagcatcgggaggagatgatgctgtcatcctattgtggaaggtgaatgataacaaggagccggagcagatcgcttttcaggatgaggacgaggcccagctgaacaaggagaactggacggttgtgaagactctgcggggccacttagaagatgtgtatgatatttgctgggcaactgatgggaatttaatggcttctgcctctgtggataacacagccatcatatgggatgtcagcaaaggacaaaagatatcaatttttaatgaacataaaagttatgtccaaggagtaacctgggaccctttgggtcaatatgttgctactctgagctgtgacagggtgctgcgagtatacagtatacagaagaagcgtgtggctttcaatgtttcgaagatgctgtctggaataggggctgaaggagaggcaagaagctaccggatgtttcacgacgacagcatgaagtctttcttccgtagactgagtttcactcccgacggatctttgcttctcacgccagctggatgtgtggaatctggtgaaaatgtaatgaataccacttatgttttctccaggaagaatcttaaaaggcccatcgctcatcttccatgtcctggaaaagccactcttgctgttcgctgctgtccggtctactttgaactgaggccagtggtggaaacaggtgtggagctgatgagtctgccctaccgcctggtgtttgctgtggcctcggaggattccgtgcttctgtatgacacccagcagtccttcccttttggttacgtgtctaatatacattaccacaccctcagtgacatttcatggtccagcgatggtgccttcctggccatttcttccacggacggttactgctcatttgtgacatttgagaaagatgaacttggaattcctttgaaagagaagccagttttgaacatgagaactcctgatacagcaaagaaaaccaagagtcagacacatcgagggtcttcgccaggacccagaccggtagagggaacccctgccagcagaacccaagaccccagcagccccggcacgactccccctcaggccagacaggccccagccccaacagtcatcagggaccctccctccatcactcctgctgtcaaaagccccttgccggggccttcggaggagaagaccctgcagcccagtagtcaaaacacaaaagcccacccatcccggagggtcactctgaacacactgcaagcctggagcaagacaacaccccggagaataaacttaacacccttaaagacggacactccaccaagttctgtaccaaccagtgtgatttccaccccttctacagaagaaattcagtcagagacgcctggagacgctcagggcagtcccccagagctaaagcggcccagactcgatgaaaacaaaggaggcacggaaagtctggacccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 71, member A
- Wolf-Hirschhorn syndrome candidate 1-like 1
- gem (nuclear organelle) associated protein 7
- FK506 binding protein 6, 36kDa pseudogene

Buy CHAF1B-chromatin assembly factor 1, subunit B (p60) Gene now

Add to cart