FAM46C-family with sequence similarity 46, member C Gene View larger

FAM46C-family with sequence similarity 46, member C Gene

PTXBC036516

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM46C-family with sequence similarity 46, member C Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM46C-family with sequence similarity 46, member C Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036516
Product type: DNA & cDNA
Ncbi symbol: FAM46C
Origin species: Human
Product name: FAM46C-family with sequence similarity 46, member C Gene
Size: 2ug
Accessions: BC036516
Gene id: 54855
Gene description: family with sequence similarity 46, member C
Synonyms: protein FAM46C; family with sequence similarity 46 member C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagaggagagcagctgtaccagggattgcatgtccttcagcgtgctcaactgggatcaggttagccggctgcatgaggtcctcactgaagttgtacctatccacggacgaggcaactttccaaccttggagataactctgaaggacatcgtccagaccgtccgcagtcggctggaggaggcaggcatcaaagtgcatgacgtccggctgaatggctccgcagctggccacgttttggtcaaagacaatggcttgggctgcaaagacctggacctaatcttccatgtggctcttccaacagaggcagaatttcagctggttagagatgtggttctgtgttcccttctgaacttcctgccagagggtgtgaacaagctcaaaatcagtccagtcactctgaaggaggcatatgtgcagaagctagtgaaggtttgcacggacactgaccgctggagcctgatctccctctccaacaagaacgggaagaacgtggagctgaagtttgtcgactccattcggcgtcagtttgagttcagtgtggactctttccaaatcatcctggattctttgcttttcttctatgactgttccaataatcccatctctgagcacttccaccccaccgtgattggggagagcatgtacggggactttgaggaagcttttgaccatctgcagaacagactgatcgccaccaagaacccagaagaaatcagaggcgggggacttctcaagtacagcaaccttcttgtgcgggacttcaggcccacagaccaggaagaaatcaaaactctagagcgctacatgtgctccaggttcttcatcgacttcccggacatccttgaacagcagaggaagttggagacttaccttcaaaaccacttcgctgaagaagagagaagcaagtacgactacctcatgatccttcgcagggtggtgaacgagagcaccgtgtgtctcatggggcatgaacgcaggcagactctgaacctcatctccctcctggccttgcgtgtgctggcggaacaaaacatcatccccagtgccaccaacgtcacctgttactaccagccggccccttacgtcagtgatggcaacttcagcaactactacgttgcccatcctccagtcacctacagccagccttaccctacctggctgccctgtaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 53, member C
- lipase A, lysosomal acid, cholesterol esterase
- microphthalmia-associated transcription factor
- creatine kinase, mitochondrial 2 (sarcomeric)

Buy FAM46C-family with sequence similarity 46, member C Gene now

Add to cart