TSSC1-tumor suppressing subtransferable candidate 1 Gene View larger

TSSC1-tumor suppressing subtransferable candidate 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TSSC1-tumor suppressing subtransferable candidate 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TSSC1-tumor suppressing subtransferable candidate 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002485
Product type: DNA & cDNA
Ncbi symbol: TSSC1
Origin species: Human
Product name: TSSC1-tumor suppressing subtransferable candidate 1 Gene
Size: 2ug
Accessions: BC002485
Gene id: 7260
Gene description: tumor suppressing subtransferable candidate 1
Synonyms: protein TSSC1; EIPR1; EARP-interacting protein; endosome-associated recycling protein-interacting protein; tumor-suppressing STF cDNA 1 protein; tumor-suppressing subchromosomal transferable fragment candidate gene 1 protein; tumor-suppressing subtransferable fragment candidate gene 1; tumor suppressing subtransferable candidate 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggacgatgcaccagtgatctacgggctggagttccaggcacgtgccttaacacctcaaactgcagaaacagatgccattcggtttttggttgggacgcagtctcttaaatatgataatcagatccatatcatagattttgacgatgaaaacaacattataaataaaaatgtcctcctccatcaagcgggtgaaatctggcatattagcgctagccctgcagacagaggtgtgctgacgacctgctacaacagaacttcagacagcaaagtcctgacatgtgcagccgtgtggaggatgccgaaggaattggaatcaggcagccacgagtcccctgatgattcatccagcactgcacagaccctggagctgctctgtcaccttgacaacacagcccatggcaacatggcctgtgtcgtgtgggagccaatgggagatgggaagaaaatcatttccttggctgataaccatatcctgctgtgggatttacaggaaagctcgagccaggctgtgctggccagctcagcgtccctggaagggaagggacaactgaagttcacctcaggacggtggagcccacatcataactgcacccaggtggccacagcgaacgacaccaccctccgtggctgggacacccggagcatgagccagatctactgcatagagaatgcccacggacagctggtgcgggaccttgactttaatcccaataagcagtactacttggccagctgcggagacgactgtaaggtgaagttctgggacacccgaaatgtcaccgaacccgtgaagaccctggaggagcactcccactgggtgtggaacgtccgctacaaccactctcatgaccagctggtcctcacgggcagcagtgacagcagagtcatcctttccaacatggtgtccatctcgtcggagcccttcggccacttggtagacgacgatgacatcagtgaccaggaggaccaccgttctgaagagaagagcaaggagcccctgcaggacaacgtgatcgccacctacgaggagcacgaggacagcgtctatgccgtggactggtcctcggctgacccgtggctgtttgcctccctgagctatgacgggaggctcgtgatcaacagggtgcccagggccctgaagtaccacatcctgctatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - minichromosome maintenance complex component 7
- family with sequence similarity 46, member C
- family with sequence similarity 53, member C
- lipase A, lysosomal acid, cholesterol esterase

Buy TSSC1-tumor suppressing subtransferable candidate 1 Gene now

Add to cart