Login to display prices
Login to display prices
CCDC86-coiled-coil domain containing 86 Gene View larger

CCDC86-coiled-coil domain containing 86 Gene

PTXBC001378

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC86-coiled-coil domain containing 86 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC86-coiled-coil domain containing 86 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001378
Product type: DNA & cDNA
Ncbi symbol: CCDC86
Origin species: Human
Product name: CCDC86-coiled-coil domain containing 86 Gene
Size: 2ug
Accessions: BC001378
Gene id: 79080
Gene description: coiled-coil domain containing 86
Synonyms: coiled-coil domain-containing protein 86; cyclon; cytokine-induced protein with coiled-coil domain; coiled-coil domain containing 86
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatacaccgttaaggcgcagccgacggctgggaggcctaaggcccgaatcccccgagagcctcacctcagtttcgcggacgagacgggcccttgtggagttcgagtcgaacccagaagaaacgagggagcccgggtctcctccgagtgtgcagcgggctggcctggggtcccccgaaaggccgccgaagacaagcccaggatcaccccgtctgcagcagggtgcaggcttggagtcaccccaagggcagccagagccaggcgcagcgtccccccagcgtcagcaagacctacacctggagtcgcctcaaagacagccagagtacagtcctgaatccccacgatgtcagccgaagccaagtgaggaggcaccaaagtgttctcaggaccagggagtactggcctcggagttggcccagaataaggaggagctgaccccgggggccccccagcatcagctaccgccggtcccaggatcaccagagccttaccccggtcagcaagctcccggtccggagccctctcagccactactggagctgacacccagggcacctggctccccccggggtcagcatgagccgagcaagccacctccagctggggagacggtgacaggcggcttcggggcaaagaagcgaaaaggttcttcatcccaggccccagcgtccaagaagttgaataaagaggagcttcctgtaatcccgaaggggaagcccaaatcggggcgagtgtggaaggaccgctccaagaaaagattctcccagatgcttcaggacaagcccctgcgcacatcgtggcagcggaagatgaaggaacgacaggagaggaagctggccaaggactttgcccgtcacctggaggaggagaaggagaggcgccgccaggagaagaaacagcgccgggctgagaacctgaaacgccgcctggagaatgagcggaaggcagaggtcgtccaagtgatccgaaaccccgccaagctcaagcgggcaaagaagaagcagctgcgctccattgagaagcgggacaccctggccctgctgcagaagcagccgccccagcagccggcagccaagatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - testis-specific serine kinase 1B
- tyrosylprotein sulfotransferase 1
- lactate dehydrogenase A-like 6B
- LAG1 homolog, ceramide synthase 4