LASS4-LAG1 homolog, ceramide synthase 4 Gene View larger

LASS4-LAG1 homolog, ceramide synthase 4 Gene

PTXBC009828

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LASS4-LAG1 homolog, ceramide synthase 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LASS4-LAG1 homolog, ceramide synthase 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009828
Product type: DNA & cDNA
Ncbi symbol: LASS4
Origin species: Human
Product name: LASS4-LAG1 homolog, ceramide synthase 4 Gene
Size: 2ug
Accessions: BC009828
Gene id: 79603
Gene description: LAG1 homolog, ceramide synthase 4
Synonyms: LASS4; Trh1; ceramide synthase 4; LAG1 homolog, ceramide synthase 4; LAG1 longevity assurance homolog 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgtccagtttcaacgagtggttttggcaggacaggttctggttaccacccaatgtcacgtggacagagctagaagaccgggatggccgtgtctacccccacccccaggacttgttggcagccctgcccctggcgctggtcctcctggccatgcgccttgcctttgagagattcattggcctgcccctgagccggtggctgggtgtgagggatcagaccaggaggcaagtgaagcccaacgccacgctggagaaacacttcctcacggaagggcacaggcccaaggagccccagctgtctctcctggccgcccagtgtggcctcacgctgcagcagacccagcgatggttccggagacgccggaaccaggatcgaccccagctgaccaagaagttctgtgaggccagctggaggtttctcttctacctgtcctccttcgtgggcggcctctcggtcctgtaccacgagtcatggctgtgggcaccagtaatgtgctgggacaggtacccaaaccagactctgaagccatccctgtactggtggtacctcttggagctgggtttctacctctcactgctaatcaggctgccctttgatgtcaagcgcaaggatttcaaggagcaggtgatacaccacttcgtggcggtcatcctgatgaccttctcctacagtgccaacctgctgcgcattggctctctggtgctgctgttacatgattcctctgactacctgctggaggcctgtaagatggtcaactacatgcagtatcagcaagtgtgcgacgctctcttcctcatcttctcctttgtcttcttctacacccgactggtcctctttcccacccagatcctctacaccacatactacgagtccatcagcaacaggggccccttcttcggctactacttcttcaacgggcttctgatgttgctgcagctgctgcacgtgttctggtcttgcctcattctgcgcatgctctatagcttcatgaagaagggccagatggagaaggacattcgtagtgatgtagaagaatcagactccagtgaggaggtggcggcggcccaggaacctctgcagctaaagaacggggcagctggagggcccaggccagcccccactgatggccctcagagccgggtggccgggcgtctgaccaacaggcacacaacagccacatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - coiled-coil domain containing 11
- coiled-coil domain containing 91
- torsin A interacting protein 1
- oxysterol binding protein-like 2

Buy LASS4-LAG1 homolog, ceramide synthase 4 Gene now

Add to cart