TPST1-tyrosylprotein sulfotransferase 1 Gene View larger

TPST1-tyrosylprotein sulfotransferase 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TPST1-tyrosylprotein sulfotransferase 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TPST1-tyrosylprotein sulfotransferase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013188
Product type: DNA & cDNA
Ncbi symbol: TPST1
Origin species: Human
Product name: TPST1-tyrosylprotein sulfotransferase 1 Gene
Size: 2ug
Accessions: BC013188
Gene id: 8460
Gene description: tyrosylprotein sulfotransferase 1
Synonyms: TANGO13A; protein-tyrosine sulfotransferase 1; TPST-1; transport and golgi organization 13 homolog A; tyrosylprotein sulfotransferase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttggaaagctgaagcagaacttactattggcatgtctggtgattagttctgtgactgtgttttacctgggccagcatgccatggaatgccatcaccggatagaggaacgtagccagccagtcaaattggagagcacaaggaccactgtgagaactggcctggacctcaaagccaacaaaacctttgcctatcacaaagatatgcctttaatatttattggaggtgtgcctcggagtggaaccacactcatgagggccatgctggacgcacatcctgacattcgctgtggagaggaaaccagggtcattccccgaatcctggccctgaagcagatgtggtcacggtcaagtaaagagaagatccgcctggatgaggctggtgttactgatgaagtgctggattctgccatgcaagccttcttactagaaattatcgttaagcatggggagccagccccttatttatgtaataaagatccttttgccctgaaatctttaacttacctttctaggttattccccaatgccaaatttctcctgatggtccgagatggccgggcatcagtacattcaatgatttctcgaaaagttactatagctggatttgatctgaacagctatagggactgtttgacaaagtggaatcgtgctatagagaccatgtataaccagtgtatggaggttggttataaaaagtgcatgttggttcactatgaacaacttgtcttacatcctgaacggtggatgagaacactcttaaagttcctccagattccatggaaccactcagtattgcaccatgaagagatgattgggaaagctgggggagtgtctctgtcaaaagtggagagatctacagaccaagtaatcaagccagtcaatgtaggagctctatcaaaatgggttgggaagataccgccagatgttttacaagacatggcagtgattgctcctatgcttgccaagcttggatatgacccatatgccaacccacctaactacggaaaacctgatcccaaaattattgaaaacactcgaagggtctataagggagaattccaactacctgactttcttaaagaaaaaccacagactgagcaagtggagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - lactate dehydrogenase A-like 6B
- LAG1 homolog, ceramide synthase 4
- coiled-coil domain containing 11
- coiled-coil domain containing 91

Buy TPST1-tyrosylprotein sulfotransferase 1 Gene now

Add to cart