LDHAL6B-lactate dehydrogenase A-like 6B Gene View larger

LDHAL6B-lactate dehydrogenase A-like 6B Gene

PTXBC022034

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LDHAL6B-lactate dehydrogenase A-like 6B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LDHAL6B-lactate dehydrogenase A-like 6B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022034
Product type: DNA & cDNA
Ncbi symbol: LDHAL6B
Origin species: Human
Product name: LDHAL6B-lactate dehydrogenase A-like 6B Gene
Size: 2ug
Accessions: BC022034
Gene id: 92483
Gene description: lactate dehydrogenase A-like 6B
Synonyms: LDH6B; LDHAL6; LDHL; L-lactate dehydrogenase A-like 6B; lactate dehydrogenase A-like 6; testicular tissue protein Li 105; lactate dehydrogenase A like 6B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagttggactgtgcctgttgtgcgggccagccagagaatgagctcggtgggagcgaatttcctatgcctggggatggccctgtgtctgcgtcaagcaacgcgcatcccgctcaacggcacctggctcttcacacccgtgagcaagatggcgactgtgaagagtgagcttattgagcgtttcacttccgagaagcccgttcatcacagtaaggtctccatcataggaactggatcggtgggcatggcctgcgctatcagcatcttattaaaaggcttgagtgatgaacttgcccttgtggatcttgatgaagacaaactgaagggtgagacgatggatcttcaacatggcagccctttcacgaaaatgccaaatattgtttgtagcaaagattactttgtcacagcaaactccaacctagtgattatcacagcaggtgcacgccaagaaaagggagaaacgcgccttaatttagtccagcgaaatgtggccatcttcaagttaatgatttccagtattgtccagtacagcccccactgcaaactgattattgtttccaatccagtggatatcttaacttatgtagcttggaagttgagtgcatttcccaaaaaccgtattattggaagcggctgtaatctggatactgctcgttttcgtttcttgattggacaaaagcttggtatccattctgaaagctgccatggatggatcctcggagagcatggagactcaagtgttcctgtgtggagtggagtgaacatagctggtgtccctttgaaggatctgaactctgatataggaactgataaagatcctgagcaatggaaaaatgtccacaaagaagtgactgcaactgcctatgagattattaaaatgaaaggttatacttcttgggccattggcctatctgtggccgatttaacagaaagtattttgaagaatcttaggagaatacatccagtttccaccataactaagggcctctatggaatagatgaagaagtattcctcagtattccttgtatcctgggagagaacggtattaccaaccttataaagataaagctgacccctgaagaagaggcccatctgaaaaaaagtgcaaaaacactctgggaaattcagaataagcttaagctttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - LAG1 homolog, ceramide synthase 4
- coiled-coil domain containing 11
- coiled-coil domain containing 91
- torsin A interacting protein 1

Buy LDHAL6B-lactate dehydrogenase A-like 6B Gene now

Add to cart