TSSK1B-testis-specific serine kinase 1B Gene View larger

TSSK1B-testis-specific serine kinase 1B Gene

PTXBC022515

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TSSK1B-testis-specific serine kinase 1B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TSSK1B-testis-specific serine kinase 1B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022515
Product type: DNA & cDNA
Ncbi symbol: TSSK1B
Origin species: Human
Product name: TSSK1B-testis-specific serine kinase 1B Gene
Size: 2ug
Accessions: BC022515
Gene id: 83942
Gene description: testis-specific serine kinase 1B
Synonyms: FKSG81; SPOGA4; STK22D; TSK1; TSSK1; testis-specific serine/threonine-protein kinase 1; TSK-1; TSSK-1; serine/threonine kinase 22D (spermiogenesis associated); serine/threonine kinase FKSG81; serine/threonine-protein kinase 22A; spermiogenesis associated 4; testis tissue sperm-binding protein Li 55e; testis-specific kinase 1; testis-specific serine kinase 1; testis specific serine kinase 1B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgacgctgctgtcctcaagcgacgaggctacctcctggggataaatttaggagagggctcctatgcaaaagtaaaatctgcttactctgagcgcctgaagttcaatgtggcgatcaagatcatcgaccgcaagaaggcccccgcagacttcttggagaaattccttccccgggaaattgagattctggccatgttaaaccactgctccatcattaagacctacgagatctttgagacatcacatggcaaggtctacatcgtcatggagctcgcggtccagggcgacctcctcgagttaatcaaaacccggggagccctgcatgaggacgaagctcgcaagaagttccaccagctttccttggccatcaagtactgccacgacctggacgtcgtccaccgggacctcaagtgtgacaaccttctccttgacaaggacttcaacatcaagctgtccgacttcagcttctccaagcgctgcctgcgggatgacagtggtcgaatggcattaagcaagaccttctgtgggtcaccagcgtatgcggccccagaggtgctgcagggcattccctaccagcccaaggtgtacgacatctggagcctaggcgtgatcctctacatcatggtctgcggctccatgccctacgacgactccaacatcaagaagatgctgcgtatccagaaggagcaccgcgtcaacttcccacgctccaagcacctgacaggcgagtgcaaggacctcatctaccacatgctgcagcccgacgtcaaccggcggctccacatcgacgagatcctcagccactgctggatgcagcccaaggcacggggatctccctctgtggccatcaacaaggagggggagagttcccggggaactgaacccttgtggacccccgaacctggctctgacaagaagtctgccaccaagctggagcctgagggagaggcacagccccaggcacagcctgagacaaaacccgaggggacagcaatgcaaatgtccaggcagtcggagatcctgggtttccccagcaagccgtcgactatggagacagaggaagggcccccccaacagcctccagagacgcgggcacagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tyrosylprotein sulfotransferase 1
- lactate dehydrogenase A-like 6B
- LAG1 homolog, ceramide synthase 4
- coiled-coil domain containing 11

Buy TSSK1B-testis-specific serine kinase 1B Gene now

Add to cart