Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
VPS29-vacuolar protein sorting 29 homolog (S. cerevisiae) Gene
PTXBC032462
New product
Data sheet of VPS29-vacuolar protein sorting 29 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VPS29-vacuolar protein sorting 29 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032462 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VPS29 |
| Origin species: | Human |
| Product name: | VPS29-vacuolar protein sorting 29 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC032462 |
| Gene id: | 51699 |
| Gene description: | vacuolar protein sorting 29 homolog (S. cerevisiae) |
| Synonyms: | VPS29, retromer complex component; vacuolar sorting protein VPS29/PEP11; DC15; DC7; PEP11; vacuolar protein sorting-associated protein 29; PEP11 homolog; hVPS29; retromer protein; vacuolar protein sorting 29 homolog; vesicle protein sorting 29; x 007 protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgagggctgcagttgcggcgaccaaggcctggctctcgggtggggtgctgcgttgttgggagccgtggggaggccgagggcgaggaattgggaaatcccggaggcctcggcgtcagggcccaggcgctggcctgggaaaggcccagaagaggtctagggaaggaagggagcggccacctctgggtgcggctggcctaggtctcgtatcccggccccaaggggccagaggccatccaaggggtaaaaaggcccctctagcagcccgacctgtcacgagacacgcacgcccgagccagggaaggcctttggtcctatacctcgaatgttccggggataggggcacggtcctccgtttccagacggttcctactcgtttcccgcaaaaagcacctcccgctggttggggtgtagtggtggaagctggcctctcggatgcagaacaggaagtagcgagcagaatttcgtacccgtttaactttgccatctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - gamma-aminobutyric acid (GABA) A receptor, alpha 2 - intraflagellar transport 57 homolog (Chlamydomonas) - G protein regulated inducer of neurite outgrowth 2 - eukaryotic translation elongation factor 1 alpha 2 |