VPS29-vacuolar protein sorting 29 homolog (S. cerevisiae) Gene View larger

VPS29-vacuolar protein sorting 29 homolog (S. cerevisiae) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VPS29-vacuolar protein sorting 29 homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about VPS29-vacuolar protein sorting 29 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032462
Product type: DNA & cDNA
Ncbi symbol: VPS29
Origin species: Human
Product name: VPS29-vacuolar protein sorting 29 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC032462
Gene id: 51699
Gene description: vacuolar protein sorting 29 homolog (S. cerevisiae)
Synonyms: VPS29, retromer complex component; vacuolar sorting protein VPS29/PEP11; DC15; DC7; PEP11; vacuolar protein sorting-associated protein 29; PEP11 homolog; hVPS29; retromer protein; vacuolar protein sorting 29 homolog; vesicle protein sorting 29; x 007 protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgagggctgcagttgcggcgaccaaggcctggctctcgggtggggtgctgcgttgttgggagccgtggggaggccgagggcgaggaattgggaaatcccggaggcctcggcgtcagggcccaggcgctggcctgggaaaggcccagaagaggtctagggaaggaagggagcggccacctctgggtgcggctggcctaggtctcgtatcccggccccaaggggccagaggccatccaaggggtaaaaaggcccctctagcagcccgacctgtcacgagacacgcacgcccgagccagggaaggcctttggtcctatacctcgaatgttccggggataggggcacggtcctccgtttccagacggttcctactcgtttcccgcaaaaagcacctcccgctggttggggtgtagtggtggaagctggcctctcggatgcagaacaggaagtagcgagcagaatttcgtacccgtttaactttgccatctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - gamma-aminobutyric acid (GABA) A receptor, alpha 2
- intraflagellar transport 57 homolog (Chlamydomonas)
- G protein regulated inducer of neurite outgrowth 2
- eukaryotic translation elongation factor 1 alpha 2

Buy VPS29-vacuolar protein sorting 29 homolog (S. cerevisiae) Gene now

Add to cart