Login to display prices
Login to display prices
VPS29-vacuolar protein sorting 29 homolog (S. cerevisiae) Gene View larger

VPS29-vacuolar protein sorting 29 homolog (S. cerevisiae) Gene

PTXBC032462

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VPS29-vacuolar protein sorting 29 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about VPS29-vacuolar protein sorting 29 homolog (S. cerevisiae) Gene

Proteogenix catalog: PTXBC032462
Ncbi symbol: VPS29
Product name: VPS29-vacuolar protein sorting 29 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC032462
Gene id: 51699
Gene description: vacuolar protein sorting 29 homolog (S. cerevisiae)
Synonyms: VPS29, retromer complex component; vacuolar sorting protein VPS29/PEP11; DC15; DC7; PEP11; vacuolar protein sorting-associated protein 29; PEP11 homolog; hVPS29; retromer protein; vacuolar protein sorting 29 homolog; vesicle protein sorting 29; x 007 protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgagggctgcagttgcggcgaccaaggcctggctctcgggtggggtgctgcgttgttgggagccgtggggaggccgagggcgaggaattgggaaatcccggaggcctcggcgtcagggcccaggcgctggcctgggaaaggcccagaagaggtctagggaaggaagggagcggccacctctgggtgcggctggcctaggtctcgtatcccggccccaaggggccagaggccatccaaggggtaaaaaggcccctctagcagcccgacctgtcacgagacacgcacgcccgagccagggaaggcctttggtcctatacctcgaatgttccggggataggggcacggtcctccgtttccagacggttcctactcgtttcccgcaaaaagcacctcccgctggttggggtgtagtggtggaagctggcctctcggatgcagaacaggaagtagcgagcagaatttcgtacccgtttaactttgccatctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: