Login to display prices
Login to display prices
DUSP7-dual specificity phosphatase 7 Gene View larger

DUSP7-dual specificity phosphatase 7 Gene

PTXBC019107

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DUSP7-dual specificity phosphatase 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DUSP7-dual specificity phosphatase 7 Gene

Proteogenix catalog: PTXBC019107
Ncbi symbol: DUSP7
Product name: DUSP7-dual specificity phosphatase 7 Gene
Size: 2ug
Accessions: BC019107
Gene id: 1849
Gene description: dual specificity phosphatase 7
Synonyms: MKPX; PYST2; dual specificity protein phosphatase 7; dual specificity protein phosphatase PYST2; dual specificity phosphatase 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgcgccgcctgcgcaagggcaacctgcccatccgctccatcatccccaaccacgccgacaaggagcgcttcgccacgcgctgcaaggcggccaccgtgctgctctacgacgaggccacggccgagtggcagcccgagcccggcgctcccgcctccgtgctcggcctgctcctacagaagctgcgcgacgacggctgccaggcctactacctccaaggtggtttcaacaagtttcaaacagagtactctgagcactgcgagaccaacgtggacagctcttcctcgccgagcagctcgccacccacctcagtgctgggcctggggggcctgcgcatcagctctgactgctccgacggcgagtcggaccgagagctgcccagcagtgccaccgagtcagacggcagccctgtgccatccagccaaccagccttccctgtccagatcctgccctacctctacctcggctgcgccaaggactccaccaacctggacgtgctcggcaagtatggcatcaagtatatcctcaatgtcacacccaacctacccaacgccttcgagcacggcggcgagttcacctacaagcagatccccatctctgaccactggagccagaacctctcccagttcttccctgaggccatcagcttcattgacgaagcccgctccaagaagtgtggtgtcctggtgcactgcctggcaggcatcagccgctcagtgacggtcactgtggcctatctgatgcagaagatgaacctgtcactcaacgacgcctacgactttgtcaagaggaaaaagtccaacatctcgcccaacttcaacttcatggggcagctgctggactttgagcggacgctggggctaagcagcccgtgcgacaaccacgcgtcgagtgagcagctctacttttccacgcccaccaaccacaacctgttcccactcaatacgctggagtccacgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: