Login to display prices
Login to display prices
FKBP8-FK506 binding protein 8, 38kDa Gene View larger

FKBP8-FK506 binding protein 8, 38kDa Gene

PTXBC009966

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FKBP8-FK506 binding protein 8, 38kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FKBP8-FK506 binding protein 8, 38kDa Gene

Proteogenix catalog: PTXBC009966
Ncbi symbol: FKBP8
Product name: FKBP8-FK506 binding protein 8, 38kDa Gene
Size: 2ug
Accessions: BC009966
Gene id: 23770
Gene description: FK506 binding protein 8, 38kDa
Synonyms: guanine nucleotide-binding protein G(z) subunit alpha; g(x) alpha chain; guanine nucleotide binding protein (G protein), alpha z polypeptide; gz-alpha; transducin alpha; G protein subunit alpha z
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggacaacccccggcggaggaggctgagcagcctggggccctggcccgagagttccttgctgccatggagcccgagcccgccccagccccggccccagaagagtggctggacattctggggaacgggctgttgaggaagaagacgctggtcccagggccgccaggttcgagccgcccggtcaagggccaggtggtcaccgtacatctgcagacgtcgctggagaatggcacacgggtgcaggaggagccggagctggtgttcactctgggtgactgtgacgtcatccaggccctggatctcagtgtcccactcatggacgtgggggagacggccatggtcactgctgactccaagtactgctacggcccccaaggcaggagcccatacatccccccgcacgcggccctgtgcctggaggtgaccctgaagacggctgtggacgggcctgacctggagatgctcacggggcaggagcgcgtggccctggccaaccggaagcgggagtgcggcaacgcccactaccagcgggcggacttcgtcctggccgccaactcctacgacctcgccatcaaggctatcacctccagcgccaaagtggacatgacgttcgaggaggaggcacagctcctgcagttgaaggtgaagtgtctgaacaacctggcggcctcgcagctgaagctcgaccactaccgcgcagccctgcgctcctgcagccttgtgctggagcaccagccagacaacatcaaggctctcttccgcaagggcaaggtgctggcccagcagggggagtacagtgaggccatccccatcctgagggcagccctgaagctggaaccttccaacaagacgatccacgcagagctctcaaagctggtgaagaagcatgcggcgcagcggagcacggagaccgccttgtaccggaaaatgctgggcaaccccagccggctgcctgctaagtgccctggcaagggtgcctggtccatcccatggaagtggctgtttggggcgactgctgttgccttggggggtgtggcactctctgtggtcatcgctgccaggaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: