TGIF1-TGFB-induced factor homeobox 1 Gene View larger

TGIF1-TGFB-induced factor homeobox 1 Gene

PTXBC031268

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TGIF1-TGFB-induced factor homeobox 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TGIF1-TGFB-induced factor homeobox 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031268
Product type: DNA & cDNA
Ncbi symbol: TGIF1
Origin species: Human
Product name: TGIF1-TGFB-induced factor homeobox 1 Gene
Size: 2ug
Accessions: BC031268
Gene id: 7050
Gene description: TGFB-induced factor homeobox 1
Synonyms: homeobox protein TGIF1; HPE4; 5'-TG-3'-interacting factor 1; TALE homeobox TG-interacting factor; transforming growth factor-beta-induced factor; TGFB induced factor homeobox 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttctagcgcagagccgggtgtctgccggggtgggctccccgcattgttcgggctccggcgggggcggctctgattcctttccatggcccgcctcccaccccgggaatccgcagtgctccttttccacggcttttctggcgtccccccgactctcccgcggcactttggcctaccttcccccagcgccgtggtcctccctggcgaccccctctgcgctcctggggtcctcctgcgccccccctcctccaccggcgcgctgcccacagccgcgtgccctctcccaggagctggggaccaaggctgggccccgccggccgcatcggtgggaacttccgcggtccccatcccagggcgcacagggtccagctcctcggcgccgactcctggaaacaatgaaaggtattgttgcagcatctggcagtgagactgaggatgaggacagcatggacattcccttggacctttcttcatccgctggctcaggcaagagaaggagaaggggcaacctacccaaggagtctgtgcagattcttcgggattggctgtatgagcaccgttacaatgcctatccttcagagcaagaaaaagcgttgctgtcccagcaaacacacctgtctacgctacaggtctgtaactggttcatcaacgcccgccgcaggctcctccctgacatgctgagaaaggatggcaaagatccaaatcagttcacaatttcccgccgtggggccaagatttctgaaacgagctctgtggagtccgtgatgggcatcaaaaacttcatgccagctctagaggagaccccatttcattcctgtacagctgggccaaacccaaccctagggaggccactgtctcctaagccgtcatccccgggatcagttttggctcgtccatcagtgatctgccataccactgtgactgcattgaaagatgtccctttctctctctgccagtcggtcggtgtgggacaaaacacagatatacagcagatagcggccaaaaacttcacagacacctctctcatgtacccagaggacacttgtaaatctggaccaagtacgaatacacagagtggtcttttcaacactcctccccctactccaccggacctcaaccaggacttcagtggatttcagcttctagtggatgttgcactcaaacgggctgcagagatggagcttcaggcaaaacttacagcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - UDP-glucuronate decarboxylase 1
- trans-golgi network protein 2
- FK506 binding protein 4, 59kDa
- fucosidase, alpha-L- 2, plasma

Buy TGIF1-TGFB-induced factor homeobox 1 Gene now

Add to cart