UXS1-UDP-glucuronate decarboxylase 1 Gene View larger

UXS1-UDP-glucuronate decarboxylase 1 Gene

PTXBC009819

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UXS1-UDP-glucuronate decarboxylase 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UXS1-UDP-glucuronate decarboxylase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009819
Product type: DNA & cDNA
Ncbi symbol: UXS1
Origin species: Human
Product name: UXS1-UDP-glucuronate decarboxylase 1 Gene
Size: 2ug
Accessions: BC009819
Gene id: 80146
Gene description: UDP-glucuronate decarboxylase 1
Synonyms: SDR6E1; UGD; UDP-glucuronic acid decarboxylase 1; UXS-1; short chain dehydrogenase/reductase family 6E, member 12; UDP-glucuronate decarboxylase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgagcaaggcgctgctgcgcctcgtgtctgccgtcaaccgcaggaggatgaagctgctgctgggcatcgccttgctggcctacgtcgcctctgtttggggcaacttcgttaatatgaggtctatccaggaaaatggtgaactaaaaattgaaagcaagattgaagagatggttgaaccactaagagagaaaatcagagatttagaaaaaagctttacccagaaatacccaccagtaaagtttttatcagaaaaggatcggaaaagaattttgataacaggaggcgcagggttcgtgggctcccatctaactgacaaactcatgatggacggccacgaggtgaccgtggtggacaatttcttcacgggcaggaagagaaacgtggagcactggatcggacatgagaacttcgagttgattaaccacgacgtggtggagcccctctacatcgaggttgaccagatataccatctggcatctccagcctcccctccaaactacatgtataatcctatcaagacattaaagaccaatacgattgggacattaaacatgttggggctggcaaaacgagtcggtgcccgtctgctcctggcctccacatcggaggtgtatggagatcctgaagtccaccctcaaagtgaggattactggggccacgtgaatccaataggacctcgggcctgctacgatgaaggcaaacgtgttgcagagaccatgtgctatgcctacatgaagcaggaaggcgtggaagtgcgagtggccagaatcttcaacacctttgggccacgcatgcacatgaacgatgggcgagtagtcagcaacttcatcctgcaggcgctccagggggagccactcacggtatacggatccgggtctcagacaagggcgttccagtacgtcagcgatctagtgaatggcctcgtggctctcatgaacagcaacgtcagcagcccggtcaacctggggaacccagaagaacacacaatcctagaatttgctcagttaattaaaaaccttgttggtagcggaagtgaaattcagtttctctccgaagcccaggatgacccacagaaaagaaaaccagacatcaaaaaagcaaagctgatgctggggtgggagcccgtggtcccgctggaggaaggtttaaacaaagcaattcactacttccgtaaagaactcgagtaccaggcaaataatcagtacatccccaaaccaaagcctgccagaataaagaaaggacggactcgccacagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - trans-golgi network protein 2
- FK506 binding protein 4, 59kDa
- fucosidase, alpha-L- 2, plasma
- BTG3 associated nuclear protein

Buy UXS1-UDP-glucuronate decarboxylase 1 Gene now

Add to cart