FUCA2-fucosidase, alpha-L- 2, plasma Gene View larger

FUCA2-fucosidase, alpha-L- 2, plasma Gene

PTXBC003060

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FUCA2-fucosidase, alpha-L- 2, plasma Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FUCA2-fucosidase, alpha-L- 2, plasma Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003060
Product type: DNA & cDNA
Ncbi symbol: FUCA2
Origin species: Human
Product name: FUCA2-fucosidase, alpha-L- 2, plasma Gene
Size: 2ug
Accessions: BC003060
Gene id: 2519
Gene description: fucosidase, alpha-L- 2, plasma
Synonyms: dJ20N2.5; plasma alpha-L-fucosidase; alpha-L-fucosidase 2; alpha-L-fucoside fucohydrolase 2; fucosidase, alpha-L- 2, plasma
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggccccaggagctccccaggctcgcgttcccgttgctgctgttgctgttgctgctgctgccgccgccgccgtgccctgcccacagcgccacgcgcttcgaccccacctgggagtccctggacgcccgccagctgcccgcgtggtttgaccaggccaagttcggcatcttcatccactggggagtgttttccgtgcccagcttcggtagcgagtggttctggtggtattggcaaaaggaaaagataccgaagtatgtggaatttatgaaagataattaccctcctagtttcaaatatgaagattttggaccactatttacagcaaaattttttaatgccaaccagtgggcagatatttttcaggcctctggtgccaaatacattgtcttaacttccaaacatcatgaaggctttaccttgtgggggtcagaatattcgtggaactggaatgccatagatgaggggcccaagagggacattgtcaaggaacttgaggtagccattaggaacagaactgacctgcgttttggactgtactattccctttttgaatggtttcatccgctcttccttgaggatgaatccagttcattccataagcggcaatttccagtttctaagacattgccagagctctatgagttagtgaacaactatcagcctgaggttctgtggtcggatggtgacggaggagcaccggatcaatactggaacagcacaggcttcttggcctggttatataatgaaagcccagttcggggcacagtagtcaccaatgatcgttggggagctggtagcatctgtaagcatggtggcttctatacctgcagtgatcgttataacccaggacatcttttgccacataaatgggaaaactgcatgacaatagacaaactgtcctggggctataggagggaagctggaatctctgactatcttacaattgaagaattggtgaagcaacttgtagagacagtttcatgtggaggaaatcttttgatgaatattgggcccacactagatggcaccatttctgtagtttttgaggagcgactgaggcaagtggggtcctggctaaaagtcaatggagaagctatttatgaaacctatacctggcgatcccagaatgacactgtcaccccagatgtgtggtacacatccaagcctaaagaaaaattagtctatgccatttttcttaaatggcccacatcaggacagctgttccttggccatcccaaagctattctgggggcaacagaggtgaaactactgggccatggacagccacttaactggatttctttggagcaaaatggcattatggtagaactgccacagctaaccattcatcagatgccgtgtaaatggggctgggctctagccctaactaatgtgatctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - BTG3 associated nuclear protein
- katanin p60 subunit A-like 1
- ariadne homolog 2 (Drosophila)
- nuclear receptor coactivator 4

Buy FUCA2-fucosidase, alpha-L- 2, plasma Gene now

Add to cart