FKBP4-FK506 binding protein 4, 59kDa Gene View larger

FKBP4-FK506 binding protein 4, 59kDa Gene

PTXBC001786

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FKBP4-FK506 binding protein 4, 59kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FKBP4-FK506 binding protein 4, 59kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001786
Product type: DNA & cDNA
Ncbi symbol: FKBP4
Origin species: Human
Product name: FKBP4-FK506 binding protein 4, 59kDa Gene
Size: 2ug
Accessions: BC001786
Gene id: 2288
Gene description: FK506 binding protein 4, 59kDa
Synonyms: peptidyl-prolyl cis-trans isomerase FKBP4; FKBP51; FKBP59; HBI; Hsp56; PPIase; p52; FK506 binding protein 4, 59kDa; HSP binding immunophilin; T-cell FK506-binding protein, 59kD; peptidylprolyl cis-trans isomerase; rotamase; FK506 binding protein 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacagccgaggagatgaaggcgaccgagagcggggcgcagtcggcgccgctgcccatggagggagtggacatcagccccaaacaggacgaaggcgtgctgaaggtcatcaagagagagggcacaggtacagagatgcccatgattggggaccgagtctttgtccactacactggctggctattagatggcacaaagtttgactccagtctggatcgcaaggacaaattctcctttgacctgggaaaaggggaggtcatcaaggcttgggacattgccatagccaccatgaaggtgggggaggtgtgccacatcacctgcaaaccagaatatgcctacggttcagcaggcagtcctccaaagattccccccaatgccacgcttgtatttgaggtggagttgtttgagtttaagggagaagatctgacggaagaggaagatggcggaatcattcgcagaatacagactcgcggtgaaggctatgctaagcccaatgagggtgctatcgtggaggttgcactggaagggtactacaaggacaagctctttgaccagcgggagctccgctttgagattggcgagggggagaacctggatctgccttatggtctggagagggccattcagcgcatggagaaaggagaacattccatcgtgtacctcaagcccagctatgcttttggcagtgttgggaaggaaaagttccaaatcccaccaaatgctgagctgaaatatgaattacacctcaagagttttgaaaaggccaaggagtcttgggagatgaattcagaagagaagctggaacagagcaccatagtgaaagagcggggcactgtgtacttcaaggaaggtaaatacaagcaagctttactacagtataagaagatcgtgtcttggctggaatatgagtctagtttttccaatgaggaagcacagaaagcacaggcccttcgactggcctctcacctcaacctggccatgtgtcatctgaaactacaggccttctctgctgccattgaaagctgtaacaaggccctagaactggacagcaacaacgagaagggcctcttccgccggggagaggcccacctggccgtgaatgactttgaactggcacgggctgatttccagaaggtcctgcagctctaccccaacaacaaagccgccaagacccagctggctgtgtgccagcagcggatccgaaggcagcttgcccgggagaagaagctctatgccaatatgtttgagaggctggctgaggaggagaacaaggccaaggcagaggcttcctcaggagaccatcccactgacacagagatgaaggaggagcagaagagcaacacggcagggagccagtctcaggtggagacagaagcatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - fucosidase, alpha-L- 2, plasma
- BTG3 associated nuclear protein
- katanin p60 subunit A-like 1
- ariadne homolog 2 (Drosophila)

Buy FKBP4-FK506 binding protein 4, 59kDa Gene now

Add to cart