DUSP6-dual specificity phosphatase 6 Gene View larger

DUSP6-dual specificity phosphatase 6 Gene

PTXBC005047

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DUSP6-dual specificity phosphatase 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DUSP6-dual specificity phosphatase 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005047
Product type: DNA & cDNA
Ncbi symbol: DUSP6
Origin species: Human
Product name: DUSP6-dual specificity phosphatase 6 Gene
Size: 2ug
Accessions: BC005047
Gene id: 1848
Gene description: dual specificity phosphatase 6
Synonyms: HH19; MKP3; PYST1; dual specificity protein phosphatase 6; MAP kinase phosphatase 3; dual specificity protein phosphatase PYST1; mitogen-activated protein kinase phosphatase 3; serine/threonine specific protein phosphatase; dual specificity phosphatase 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatagatacgctcagacccgtgcccttcgcgtcggaaatggcgatcagcaagacggtggcgtggctcaacgagcagctggagctgggcaacgagcggctgctgctgatggactgccggccgcaggagctatacgagtcgtcgcacatcgagtcggccatcaacgtggccatcccgggcatcatgctgcggcgcctgcagaagggtaacctgccggtgcgcgcgctcttcacgcgcggcgaggaccgggaccgcttcacccggcgctgtggcaccgacacagtggtgctctacgacgagagcagcagcgactggaacgagaatacgggcggcgagtcggtgctcgggctgctgctcaagaagctcaaggacgagggctgccgggcgttctacctggaaggtggcttcagtaagttccaagccgagttctccctgcattgcgagaccaatctagacggctcgtgtagcagcagctcgccgccgttgccagtgctggggctcgggggcctgcggatcagctctgactcttcctcggacatcgagtctgaccttgaccgagaccccaatagtgcaacagactcggatggtagtccgctgtccaacagccagccttccttcccagtggagatcttgcccttcctctacttgggctgtgccaaagactccaccaacttggacgtgttggaggaattcggcatcaagtacatcttgaacgtcacccccaatttgccgaatctctttgagaacgcaggagagtttaaatacaagcaaatccccatctcggatcactggagccaaaacctgtcccagtttttccctgaggccatttctttcatagatgaagcccggggcaagaactgtggtgtcttggtacattgcttggctggcattagccgctcagtcactgtgactgtggcttaccttatgcagaagctcaatctgtcgatgaacgatgcctatgacattgtcaaaatgaaaaaatccaacatatcccctaacttcaacttcatgggtcagctgctggacttcgagaggacgctgggactcagcagcccatgtgacaacagggttccagcacagcagctgtattttaccaccccttccaaccagaatgtataccaggtggactctctgcaatctacgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAD51-like 1 (S. cerevisiae)
- tumor susceptibility gene 101
- TGFB-induced factor homeobox 1
- UDP-glucuronate decarboxylase 1

Buy DUSP6-dual specificity phosphatase 6 Gene now

Add to cart