TSG101-tumor susceptibility gene 101 Gene View larger

TSG101-tumor susceptibility gene 101 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TSG101-tumor susceptibility gene 101 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TSG101-tumor susceptibility gene 101 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002487
Product type: DNA & cDNA
Ncbi symbol: TSG101
Origin species: Human
Product name: TSG101-tumor susceptibility gene 101 Gene
Size: 2ug
Accessions: BC002487
Gene id: 7251
Gene description: tumor susceptibility gene 101
Synonyms: ESCRT-I complex subunit TSG101; TSG10; VPS23; tumor susceptibility gene 101 protein; tumor susceptibility gene 10; tumor susceptibility gene 101; tumor susceptibility protein; tumor susceptibility 101
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggtgtcggagagccagctcaagaaaatggtgtccaagtacaaatacagagacctaactgtacgtgaaactgtcaatgttattactctatacaaagatctcaaacctgttttggattcatatgtttttaacgatggcagttccagggaactaatgaacctcactggaacaatccctgtgccttatagaggtaatacatacaatattccaatatgcctatggctactggacacatacccatataatccccctatctgttttgttaagcctactagttcaatgactattaaaacaggaaagcatgttgatgcaaatgggaagatatatcttccttatctacatgaatggaaacacccacagtcagacttgttggggcttattcaggtcatgattgtggtatttggagatgaacctccagtcttctctcgtcctatttcggcatcctatccgccataccaggcaacggggccaccaaatacttcctacatgccaggcatgccaggtggaatctctccatacccatccggataccctcccaatcccagtggttacccaggctgtccttacccacctggtggtccatatcctgccacaacaagttctcagtacccttctcagcctcctgtgaccactgttggtcccagtagggatggcacaatcagcgaggacaccatccgagcctctctcatctctgcggtcagtgacaaactgagatggcggatgaaggaggaaatggatcgtgcccaggcagagctcaatgccttgaaacgaacagaagaagacctgaaaaagggtcaccagaaactggaagagatggttacccgtttagatcaagaagtagccgaggttgataaaaacatagaacttttgaaaaagaaggatgaagaactcagttctgctctggaaaaaatggaaaatcagtctgaaaacaatgatatcgatgaagttatcattcccacagctcccttatacaaacagatcctgaatctgtatgcagaagaaaacgctattgaagacactatcctttacttgggagaagccttgagaaggggcgtgatagacctggatgtcttcctgaagcatgtacgtcttctgtcccgtaaacagttccagctgagggcactaatgcaaaaagcaagaaagactgccggtctcagtgacctctactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TGFB-induced factor homeobox 1
- UDP-glucuronate decarboxylase 1
- trans-golgi network protein 2
- FK506 binding protein 4, 59kDa

Buy TSG101-tumor susceptibility gene 101 Gene now

Add to cart