Login to display prices
Login to display prices
SPA17-sperm autoantigenic protein 17 Gene View larger

SPA17-sperm autoantigenic protein 17 Gene

PTXBC032457

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPA17-sperm autoantigenic protein 17 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPA17-sperm autoantigenic protein 17 Gene

Proteogenix catalog: PTXBC032457
Ncbi symbol: SPA17
Product name: SPA17-sperm autoantigenic protein 17 Gene
Size: 2ug
Accessions: BC032457
Gene id: 53340
Gene description: sperm autoantigenic protein 17
Synonyms: CT22; SP17; SP17-1; sperm surface protein Sp17; cancer/testis antigen 22; sperm autoantigenic protein 17
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgattccattctccaacacccactaccgaattccacaaggatttgggaatcttcttgaagggctgacacgcgagattctgagagagcaaccggacaatataccagcttttgcagcagcctattttgagagccttctagagaaaagagagaaaaccaactttgatccagcagaatgggggagtaaggtagaagaccgcttctataacaatcatgcattcgaggagcaagaaccacctgagaaaagtgatcctaaacaagaagagtctcagatatctgggaaggaggaagagacatcagtcaccatcttagactcttctgaggaagataaggaaaaagaagaggttgctgctgtcaaaatccaagctgccttccggggacacatagccagagaggaggcaaagaaaatgaaaacaaatagtcttcaaaatgaggaaaaagaggaaaacaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: