PTH1R-parathyroid hormone 1 receptor Gene View larger

PTH1R-parathyroid hormone 1 receptor Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PTH1R-parathyroid hormone 1 receptor Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PTH1R-parathyroid hormone 1 receptor Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031578
Product type: DNA & cDNA
Ncbi symbol: PTH1R
Origin species: Human
Product name: PTH1R-parathyroid hormone 1 receptor Gene
Size: 2ug
Accessions: BC031578
Gene id: 5745
Gene description: parathyroid hormone 1 receptor
Synonyms: PFE; PTHR; PTHR1; parathyroid hormone/parathyroid hormone-related peptide receptor; PTH/PTHr receptor; PTH/PTHrP type I receptor; PTH1 receptor; parathyroid hormone receptor 1; parathyroid hormone/parathyroid hormone-related protein receptor; seven transmembrane helix receptor; parathyroid hormone 1 receptor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggaccgcccggatcgcacccggcctggcgctcctgctctgctgccccgtgctcagctccgcgtacgcgctggtggatgcagatgacgtcatgactaaagaggaacagatcttcctgctgcaccgtgctcaggcccagtgcgaaaaacggctcaaggaggtcctgcagaggccagccagcataatggaatcagacaagggatggacatctgcgtccacatcagggaagcccaggaaagataaggcatctgggaagctctaccctgagtctgaggaggacaaggaggcacccactggcagcaggtaccgagggcgcccctgtctgccggaatgggaccacatcctgtgctggccgctgggggcaccaggtgaggtggtggctgtgccctgtccggactacatttatgacttcaatcacaaaggccatgcctaccgacgctgtgaccgcaatggcagctgggagctggtgcctgggcacaacaggacgtgggccaactacagcgagtgtgtcaaatttctcaccaatgagactcgtgaacgggaggtgtttgaccgcctgggcatgatttacaccgtgggctactccgtgtccctggcgtccctcaccgtagctgtgctcatcctggcctactttaggcggctgcactgcacgcgcaactacatccacatgcacctgttcctgtccttcatgctgcgcgccgtgagcatcttcgtcaaggacgctgtgctctactctggcgccacgcttgatgaggctgagcgcctcaccgaggaggagctgcgcgccatcgcccaggcgcccccgccgcctgccaccgccgctgccggctacgcgggctgcagggtggctgtgaccttcttcctttacttcctggccaccaactactactggattctggtggaggggctgtacctgcacagcctcatcttcatggccttcttctcagagaagaagtacctgtggggcttcacagtcttcggctggggtgctgggacttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - FK506 binding protein 8, 38kDa
- dual specificity phosphatase 6
- RAD51-like 1 (S. cerevisiae)
- tumor susceptibility gene 101

Buy PTH1R-parathyroid hormone 1 receptor Gene now

Add to cart