SPRY2-sprouty homolog 2 (Drosophila) Gene View larger

SPRY2-sprouty homolog 2 (Drosophila) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPRY2-sprouty homolog 2 (Drosophila) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SPRY2-sprouty homolog 2 (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015745
Product type: DNA & cDNA
Ncbi symbol: SPRY2
Origin species: Human
Product name: SPRY2-sprouty homolog 2 (Drosophila) Gene
Size: 2ug
Accessions: BC015745
Gene id: 10253
Gene description: sprouty homolog 2 (Drosophila)
Synonyms: IGAN3; hSPRY2; protein sprouty homolog 2; sprouty RTK signaling antagonist 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggccagagctcagagtggcaacgggtcgcagcccttgctgcagacgccccgtgacggtggcagacagcgtggggagcccgaccccagagacgccctcacccagcaggtacatgtcttgtctctggatcagatcagagccatccgaaacaccaatgagtacacagaggggcctactgtcgtcccaagacctgggctcaagcctgctcctcgcccctccactcagcacaaacacgagagactccacggtctgcctgagcaccgccagcctcctaggctccagcactcgcaggtccattcttctgcacgagcccctctgtccagatccataagcacggtcagctcagggtcgcggagcagtacgaggacaagtaccagcagcagctcctctgaacagagactgctaggatcatccttctcctccgggcctgttgctgatggcataatccgggtgcaacccaaatctgagctcaagccaggtgagcttaagccactgagcaaggaagatttgggcctgcacgcctacaggtgtgaggactgtggcaagtgcaaatgtaaggagtgcacctacccaaggcctctgccatcagactggatctgcgacaagcagtgcctttgctcggcccagaacgtgattgactatgggacttgtgtatgctgtgtgaaaggtctcttctatcactgttctaatgatgatgaggacaactgtgctgacaacccatgttcttgcagccagtctcactgttgtacacgatggtcagccatgggtgtcatgtccctctttttgccttgtttatggtgttaccttccagccaagggttgccttaaattgtgccaggggtgttatgaccgggttaacaggcctggttgccgctgtaaaaactcaaacacagtttgctgcaaagttcccactgtcccccctaggaactttgaaaaaccaacatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dual specificity phosphatase 7
- sperm autoantigenic protein 17
- parathyroid hormone 1 receptor
- FK506 binding protein 8, 38kDa

Buy SPRY2-sprouty homolog 2 (Drosophila) Gene now

Add to cart