NAPRT1-nicotinate phosphoribosyltransferase domain containing 1 Gene View larger

NAPRT1-nicotinate phosphoribosyltransferase domain containing 1 Gene

PTXBC032466

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NAPRT1-nicotinate phosphoribosyltransferase domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NAPRT1-nicotinate phosphoribosyltransferase domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032466
Product type: DNA & cDNA
Ncbi symbol: NAPRT1
Origin species: Human
Product name: NAPRT1-nicotinate phosphoribosyltransferase domain containing 1 Gene
Size: 2ug
Accessions: BC032466
Gene id: 93100
Gene description: nicotinate phosphoribosyltransferase domain containing 1
Synonyms: NAPRT1; PP3856; nicotinate phosphoribosyltransferase; FHA-HIT-interacting protein; NAPRTase; nicotinate phosphoribosyltransferase domain containing 1; nicotinate phosphoribosyltransferase domain-containing protein 1; nicotinic acid phosphoribosyltransferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttggcgccagcagctggtgagggccctggggtggacctggcggccaaagcccaggtgtggctggagcaggtgtgtgcccacctggggctgggggtgcaggagccacatccaggcgagcgggcagcctttgtggcctatgccttggcttttccccgggccttccagggcctcctggacacctacagcgtgtggaggagtggtctccccaacttcctagcagtcgccttggccctgggagagctgggctaccgggcagtgggcgtgaggctggacagtggtgacctgctacagcaggctcaggagatccgcaaggtcttccgagctgctgcagcccagttccaggtgccctggctggagtcagtcctcatcgtagtcagcaacaacattgacgaggaggcgctggcccgactggcccaggagggcagtgaggtgaatgtcattggcattggcaccagtgtggtcacctgcccccaacagccttccctgggtggcgtctataagctggtggccgtggggggccagccacgaatgaagctgaccgaggaccccgagaagcagacgttgcctgggagcaaggctgctttccggctcctgggctctgacgggtctccactcatggacatgctgcagttagcagaagagccagtgccacaggctgggcaggagctgagggtgtggcctccaggggcccaggagccctgcaccgtgaggccagcccaggtggagccactactgcggctctgcctccagcagggacagctgtgtgagccgctcccatccctggcagagtctagagccttggcccagctgtccctgagccgactcagccctgagcacaggcggctgcggagccctgcacagtaccaggtggtgctgtccgagaggctgcaggccctggtgaacagtctgtgtgcggggcagtccccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RRS1 ribosome biogenesis regulator homolog (S. cerevisiae)
- coagulation factor C homolog, cochlin (Limulus polyphemus)
- polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa
- cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa

Buy NAPRT1-nicotinate phosphoribosyltransferase domain containing 1 Gene now

Add to cart