Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NAPRT1-nicotinate phosphoribosyltransferase domain containing 1 Gene
PTXBC032466
New product
Data sheet of NAPRT1-nicotinate phosphoribosyltransferase domain containing 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NAPRT1-nicotinate phosphoribosyltransferase domain containing 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032466 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NAPRT1 |
| Origin species: | Human |
| Product name: | NAPRT1-nicotinate phosphoribosyltransferase domain containing 1 Gene |
| Size: | 2ug |
| Accessions: | BC032466 |
| Gene id: | 93100 |
| Gene description: | nicotinate phosphoribosyltransferase domain containing 1 |
| Synonyms: | NAPRT1; PP3856; nicotinate phosphoribosyltransferase; FHA-HIT-interacting protein; NAPRTase; nicotinate phosphoribosyltransferase domain containing 1; nicotinate phosphoribosyltransferase domain-containing protein 1; nicotinic acid phosphoribosyltransferase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttggcgccagcagctggtgagggccctggggtggacctggcggccaaagcccaggtgtggctggagcaggtgtgtgcccacctggggctgggggtgcaggagccacatccaggcgagcgggcagcctttgtggcctatgccttggcttttccccgggccttccagggcctcctggacacctacagcgtgtggaggagtggtctccccaacttcctagcagtcgccttggccctgggagagctgggctaccgggcagtgggcgtgaggctggacagtggtgacctgctacagcaggctcaggagatccgcaaggtcttccgagctgctgcagcccagttccaggtgccctggctggagtcagtcctcatcgtagtcagcaacaacattgacgaggaggcgctggcccgactggcccaggagggcagtgaggtgaatgtcattggcattggcaccagtgtggtcacctgcccccaacagccttccctgggtggcgtctataagctggtggccgtggggggccagccacgaatgaagctgaccgaggaccccgagaagcagacgttgcctgggagcaaggctgctttccggctcctgggctctgacgggtctccactcatggacatgctgcagttagcagaagagccagtgccacaggctgggcaggagctgagggtgtggcctccaggggcccaggagccctgcaccgtgaggccagcccaggtggagccactactgcggctctgcctccagcagggacagctgtgtgagccgctcccatccctggcagagtctagagccttggcccagctgtccctgagccgactcagccctgagcacaggcggctgcggagccctgcacagtaccaggtggtgctgtccgagaggctgcaggccctggtgaacagtctgtgtgcggggcagtccccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) - coagulation factor C homolog, cochlin (Limulus polyphemus) - polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa - cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa |