Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
IFT20-intraflagellar transport 20 homolog (Chlamydomonas) Gene
PTXBC038094
New product
Data sheet of IFT20-intraflagellar transport 20 homolog (Chlamydomonas) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IFT20-intraflagellar transport 20 homolog (Chlamydomonas) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC038094 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IFT20 |
| Origin species: | Human |
| Product name: | IFT20-intraflagellar transport 20 homolog (Chlamydomonas) Gene |
| Size: | 2ug |
| Accessions: | BC038094 |
| Gene id: | 90410 |
| Gene description: | intraflagellar transport 20 homolog (Chlamydomonas) |
| Synonyms: | intraflagellar transport protein IFT20; intraflagellar transport protein 20 homolog; intraflagellar transport 20 homolog; intraflagellar transport 20 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccaaggacatcctgggtgaagcagggctacactttgatgaactgaacaagctgagggtgttggacccagaggttacccagcagaccatagagctgaaggaagagtgcaaagactttgtggacaaaattggccagtttcagaaaatagttggtggtttaattgagcttgttgatcaacttgcaaaagaagcagaaaatgaaaagatgaaggccatcggtgctcggaacttgctcaaatctatagcaaagcagagagaagctcaacagcagcaacttcaagccctaatagcagaaaagaaaatgcagctagaaaggtatcgggttgaatatgaagctttgtgtaaagtagaagcagaacaaaatgaatttattgaccaatttatttttcagaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - vacuolar protein sorting 29 homolog (S. cerevisiae) - gamma-aminobutyric acid (GABA) A receptor, alpha 2 - intraflagellar transport 57 homolog (Chlamydomonas) - G protein regulated inducer of neurite outgrowth 2 |