Login to display prices
Login to display prices
GFOD2-glucose-fructose oxidoreductase domain containing 2 Gene View larger

GFOD2-glucose-fructose oxidoreductase domain containing 2 Gene

PTXBC000757

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GFOD2-glucose-fructose oxidoreductase domain containing 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GFOD2-glucose-fructose oxidoreductase domain containing 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000757
Product type: DNA & cDNA
Ncbi symbol: GFOD2
Origin species: Human
Product name: GFOD2-glucose-fructose oxidoreductase domain containing 2 Gene
Size: 2ug
Accessions: BC000757
Gene id: 81577
Gene description: glucose-fructose oxidoreductase domain containing 2
Synonyms: glucose-fructose oxidoreductase domain-containing protein 2; glucose-fructose oxidoreductase domain containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgacagcctcgcgctactacccgcagctcatgagcctggtagggaacgtgctgcgcttcctgcctgccttcgtgcgcatgaaacagctgatttcggaacactatgtgggagcggtgatgatctgtgatgcccgcatctactcaggcagcctgctgagccccagctatggctggatctgtgatgagctcatgggcggcgggggcttgcacaccatggggacctacattgtggacctgctgacccacctgaccggccggagagccgagaaggtgcacgggctgctcaagacattcgtgaggcagaacgctgccatccgtggcatccggcacgtcactagcgatgacttctgtttcttccagatgctcatgggtgggggtgtgtgtagcacagtgacactcaacttcaacatgccaggcgcctttgtgcatgaagtcatggtggtaggctctgcaggacgcctcgtcgcccggggagccgacctctatgggcagaagaactctgccacgcaagaggagctgctcttgagggactcgctggcagtgggcgcaggactgcctgagcaggggccccaggatgtcccgctgctgtacctgaagggcatggtctacatggtgcaggccttgcgccagtccttccaggggcagggcgaccgccgcacctgggaccgcacccctgtctccatggccgcctccttcgaggatgggctgtacatgcagagcgtggtggatgccatcaagaggtcgagccgatccggggagtgggaggctgtggaggtgctgacggaggagcccgacaccaaccagaacctgtgtgaggcacttcagcggaacaacctatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - intraflagellar transport 20 homolog (Chlamydomonas)
- vacuolar protein sorting 29 homolog (S. cerevisiae)
- gamma-aminobutyric acid (GABA) A receptor, alpha 2
- intraflagellar transport 57 homolog (Chlamydomonas)