PDCL2-phosducin-like 2 Gene View larger

PDCL2-phosducin-like 2 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDCL2-phosducin-like 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PDCL2-phosducin-like 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034431
Product type: DNA & cDNA
Ncbi symbol: PDCL2
Origin species: Human
Product name: PDCL2-phosducin-like 2 Gene
Size: 2ug
Accessions: BC034431
Gene id: 132954
Gene description: phosducin-like 2
Synonyms: GCPHLP; phosducin-like protein 2; phosducin like 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaggatcccaatgaagatacagaatggaatgacattttaagagatttcggcattcttcctcctaaagaagagtcaaaagatgaaattgaagaaatggttttacgtttacagaaagaagcaatggtgaaaccatttgaaaagatgactcttgcacagctaaaggaagctgaagatgaatttaatgaagaagatatgcaggctgttgaaacatatagaaagaagcggttacaggaatggaaagctcttaagaaaaaacaaaaatttggagaattaagagaaatttctggaaatcagtatgtgaatgaagtcacaaatgcagaagaagatgtgtgggttataattcatctatacagatcaagcatcccaatgtgtttgttggttaaccagcatcttagtcttctagcaagaaagtttccagaaactaaatttgttaaagccatcgtgaatagctgtattcaacactaccatgacaattgtttaccaacaatttttgtgtataaaaatggtcagatagaagccaaattcattggaattatagaatgtggagggataaatctcaagctggaagaacttgaatggaagctagcagaagttggagcaatacagactgatttggaagaaaaccccagaaaagacatggtagatatgatggtatcttcaattagaaacacttctattcatgatgacagtgatagctccaacagtgataatgaaccaaatagagagaaatattcaataaatagcttttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sorting nexin 11
- Obg-like ATPase 1
- CD300a molecule
- tetraspanin 16

Buy PDCL2-phosducin-like 2 Gene now

Add to cart