Login to display prices
Login to display prices
SNX11-sorting nexin 11 Gene View larger

SNX11-sorting nexin 11 Gene

PTXBC000768

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNX11-sorting nexin 11 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SNX11-sorting nexin 11 Gene

Proteogenix catalog: PTXBC000768
Ncbi symbol: SNX11
Product name: SNX11-sorting nexin 11 Gene
Size: 2ug
Accessions: BC000768
Gene id: 29916
Gene description: sorting nexin 11
Synonyms: sorting nexin-11; sorting nexin 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcttttggtgtaggatgtcggagaaccaagaacaggaggaggtgattacagtgcgtgttcaggacccccgagtgcagaatgagggctcctggaactcttatgtggattataagatattcctccataccaacagcaaagcctttactgccaagacttcctgtgtgcggcgccgctaccgtgagttcgtgtggctgagaaagcagctacagagaaatgctggtttggtgcctgttcctgaacttcctgggaagtcaaccttcttcggcacctcagatgagttcattgagaagcgacgacaaggtctgcagcacttccttgaaaaggtcctgcagagtgtggttctcctgtcagacagccagttgcacctattcctgcaaagccagctctcggtgcctgagatagaagcctgtgtccagggccgaagtaccatgactgtgtctgatgccattcttcgatatgctatgtcaaactgtggctgggcccaggaagagaggcagagctcttctcacctggctaaaggagaccagcctaagagttgctgctttcttccaagatcgggtaggaggagctctccctcaccgcctcccagtgaagaaaaggaccatttagaagtgtgggctccagttgttgactctgaggttccttccttggaaagtcccactctcccacccctctcctcaccattatgctgtgattttggaagacccaaagagggaacctccactcttcagtctgtgaggagggctgtgggaggagatcatgctgtgcctttggaccctggtcagttagaaacagttttggaaaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: