Login to display prices
Login to display prices
NDUFV2-NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa Gene View larger

NDUFV2-NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NDUFV2-NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NDUFV2-NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001632
Product type: DNA & cDNA
Ncbi symbol: NDUFV2
Origin species: Human
Product name: NDUFV2-NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa Gene
Size: 2ug
Accessions: BC001632
Gene id: 4729
Gene description: NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa
Synonyms: CI-24k; NADH dehydrogenase [ubiquinone] flavoprotein 2, mitochondrial; NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa; NADH dehydrogenase ubiquinone flavoprotein 2, mitochondrial; NADH-ubiquinone oxidoreductase 24 kDa subunit; NADH-ubiquinone oxidoreductase flavoprotein 2; complex I 24kDa subunit; complex I, mitochondrial respitory chain, 24 kD subunit; nuclear-encoded mitochondrial NADH-ubiquinone reductase 24Kd subunit; NADH:ubiquinone oxidoreductase core subunit V2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttcttctccgcggcgctccgggcccgggcggctggcctcaccgcccactggggaagacatgtaaggaatttgcataagacagttatgcaaaatggagctggaggagctttatttgtgcacagagatactcctgagaataaccctgatactccatttgatttcacaccagaaaactataagaggatagaggcaattgtaaaaaactatccagaaggccataaagcagcagctgttcttccagtcctggatttagcccaaaggcagaatgggtggttgcccatctctgctatgaacaaggttgcagaagttttacaagtacctccaatgagagtatatgaagtagcaactttttatacaatgtataatcgaaagccagttggaaagtatcacattcaggtctgcactactacaccctgcatgcttcgaaactctgacagcatactggaggccattcagaaaaagcttggaataaaggttggggagactacacctgacaaacttttcactcttatagaagtggaatgtttaggggcctgtgtgaacgcaccaatggttcaaataaatgacaattactatgaggatttgacagctaaggatattgaagaaattattgatgagctcaaggctggcaaaatcccaaaaccagggccaaggagtggacgcttctcttgtgagccagctggaggtcttacctctttgactgaaccacccaagggacctggatttggtgtacaagcaggcctttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Fc fragment of IgG, low affinity IIa, receptor (CD32)
- membrane-bound transcription factor peptidase, site 2
- GATA binding protein 1 (globin transcription factor 1)
- SAM pointed domain containing ets transcription factor