Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
FCGR2A-Fc fragment of IgG, low affinity IIa, receptor (CD32) Gene
PTXBC019931
New product
Data sheet of FCGR2A-Fc fragment of IgG, low affinity IIa, receptor (CD32) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FCGR2A-Fc fragment of IgG, low affinity IIa, receptor (CD32) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC019931 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FCGR2A |
| Origin species: | Human |
| Product name: | FCGR2A-Fc fragment of IgG, low affinity IIa, receptor (CD32) Gene |
| Size: | 2ug |
| Accessions: | BC019931 |
| Gene id: | 2212 |
| Gene description: | Fc fragment of IgG, low affinity IIa, receptor (CD32) |
| Synonyms: | CD32A; CDw32; FCG2; FCGR2; FCGR2A1; FcGR; IGFR2; low affinity immunoglobulin gamma Fc region receptor II-a; Fc fragment of IgG, low affinity IIa, receptor (CD32); Immunoglobulin G Fc receptor II; fc-gamma-RIIa; fcRII-a; igG Fc receptor II-a; Fc fragment of IgG receptor IIa |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgactatggagacccaaatgtctcagaatgtatgtcccagaaacctgtggctgcttcaaccattgacagttttgctgctgctggcttctgcagacagtcaagctgctcccccaaaggctgtgctgaaacttgagcccccgtggatcaacgtgctccaggaggactctgtgactctgacatgccagggggctcgcagccctgagagcgactccattcagtggttccacaatgggaatctcattcccacccacacgcagcccagctacaggttcaaggccaacaacaatgacagcggggagtacacgtgccagactggccagaccagcctcagcgaccctgtgcatctgactgtgctttccgaatggctggtgctccagacccctcacctggagttccaggagggagaaaccatcatgctgaggtgccacagctggaaggacaagcctctggtcaaggtcacattcttccagaatggaaaatcccagaaattctcccgtttggatcccaccttctccatcccacaagcaaaccacagtcacagtggtgattaccactgcacaggaaacataggctacacgctgttctcatccaagcctgtgaccatcactgtccaagtgcccagcatgggcagctcttcaccaatggggatcattgtggctgtggtcattgcgactgctgtagcagccattgttgctgctgtagtggccttgatctactgcaggaaaaagcggatttcagccaattccactgatcctgtgaaggctgcccaatttgagccacctggacgtcaaatgattgccatcagaaagagacaacttgaagaaaccaacaatgactatgaaacagctgacggcggctacatgactctgaaccccagggcacctactgacgatgataaaaacatctacctgactcttcctcccaacgaccatgtcaacagtaataactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - membrane-bound transcription factor peptidase, site 2 - GATA binding protein 1 (globin transcription factor 1) - SAM pointed domain containing ets transcription factor - DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae) |