Login to display prices
Login to display prices
SPDEF-SAM pointed domain containing ets transcription factor Gene View larger

SPDEF-SAM pointed domain containing ets transcription factor Gene

PTXBC021299

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPDEF-SAM pointed domain containing ets transcription factor Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPDEF-SAM pointed domain containing ets transcription factor Gene

Proteogenix catalog: PTXBC021299
Ncbi symbol: SPDEF
Product name: SPDEF-SAM pointed domain containing ets transcription factor Gene
Size: 2ug
Accessions: BC021299
Gene id: 25803
Gene description: SAM pointed domain containing ets transcription factor
Synonyms: BCKDKD; BDK; [3-methyl-2-oxobutanoate dehydrogenase [lipoamide]] kinase, mitochondrial; BCKD-kinase; BCKDHKIN; branched chain alpha-ketoacid dehydrogenase kinase; branched chain ketoacid dehydrogenase kinase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcagcgccagcccgggtctgagcagcgtatcccccagccacctcctgctgccccccgacacggtgtcgcggacaggcttggagaaggcggcagcgggggcagtgggtctcgagagacgggactggagtcccagtccacccgccacgcccgagcagggcctgtccgccttctacctctcctactttgacatgctgtaccctgaggacagcagctgggcagccaaggcccctggggccagcagtcgggaggagccacctgaggagcctgagcagtgcccggtcattgacagccaagccccagcgggcagcctggacttggtgcccggcgggctgaccttggaggagcactcgctggagcaggtgcagtccatggtggtgggcgaagtgctcaaggacatcgagacggcctgcaagctgctcaacatcaccgcagatcccatggactggagccccagcaatgtgcagaagtggctcctgtggacagagcaccaataccggctgccccccatgggcaaggccttccaggagctggcgggcaaggagctgtgcgccatgtcggaggagcagttccgccagcgctcgcccctgggtggggatgtgctgcacgcccacctggacatctggaagtcagcggcctggatgaaagagcggacttcacctggggcgattcactactgtgcctcgaccagtgaggagagctggaccgacagcgaggtggactcatcatgctccgggcagcccatccacctgtggcagttcctcaaggagttgctactcaagccccacagctatggccgcttcattaggtggctcaacaaggagaagggcatcttcaaaattgaggactcagcccaggtggcccggctgtggggcatccgcaagaaccgtcccgccatgaactacgacaagctgagccgctccatccgccagtattacaagaagggcatcatccggaagccagacatctcccagcgcctcgtctaccagttcgtgcaccccatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: