MBTPS2-membrane-bound transcription factor peptidase, site 2 Gene View larger

MBTPS2-membrane-bound transcription factor peptidase, site 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MBTPS2-membrane-bound transcription factor peptidase, site 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MBTPS2-membrane-bound transcription factor peptidase, site 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036465
Product type: DNA & cDNA
Ncbi symbol: MBTPS2
Origin species: Human
Product name: MBTPS2-membrane-bound transcription factor peptidase, site 2 Gene
Size: 2ug
Accessions: BC036465
Gene id: 51360
Gene description: membrane-bound transcription factor peptidase, site 2
Synonyms: BRESEK; IFAP; KFSD; KFSDX; OLMSX; S2P; membrane-bound transcription factor site-2 protease; SREBPs intramembrane protease; endopeptidase S2P; keratosis follicularis spinulosa decalvans; membrane-bound transcription factor protease, site 2; site-2 protease; sterol regulatory element-binding proteins intramembrane protease; membrane bound transcription factor peptidase, site 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgattccggtgtcgctggtggtggtggtggtgggtggctggactgtcgtctacctgaccgacttggtgctggagtcatctgtctattttaaacattcttatgaagactggctggaaaacaacggactgagcatctcccctttccacataagatggcaaactgctgttttcaatcgtgccttttacagttggggacggcggaaagcaaggatgctttaccagtggttcaattttggaatggtgtttggcgtaattgccatgtttagctcattttttctccttggaaaaacgctgatgcagactttggcacaaatgatggctgactctccctcttcttattcttcctcctcttcttcctcttcctcctcttcttcctcttcctcttcttcatcttcttcctcttcctcgcttcacaatgaacaggtgttacaagttgtggttcctggtataaatttacccgtcaatcaactgacctatttcttcacggcagttctcattagtggtgttgtacatgaaattggacatgggatagcagctattagggaacaagttcgatttaatggctttgggatttttctcttcattatttatcctggagcatttgttgatctgttcaccactcatttgcaacttatatcgccagtccagcagctaaggatattttgtgcaggtatctggcataattttgtccttgcactcttgggtattttagctcttgttctcctcccagtaattctcttgccattttactacactggagttggggtgctcatcactgaagttgctgaggactctcctgccattggacccagaggcctttttgtgggagaccttgtcacccatctacaggattgtcctgttactaatgtgcaagattggaatgaatgtttagataccatcgcctatgagccccaaattggttactgtataagtgcatcaactttacagcagttaagtttcccagttagaggtgtgtatatttcctcaatataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - GATA binding protein 1 (globin transcription factor 1)
- SAM pointed domain containing ets transcription factor
- DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae)
- proteasome (prosome, macropain) 26S subunit, ATPase, 4

Buy MBTPS2-membrane-bound transcription factor peptidase, site 2 Gene now

Add to cart