Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MBTPS2-membrane-bound transcription factor peptidase, site 2 Gene
PTXBC036465
New product
Data sheet of MBTPS2-membrane-bound transcription factor peptidase, site 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MBTPS2-membrane-bound transcription factor peptidase, site 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC036465 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MBTPS2 |
| Origin species: | Human |
| Product name: | MBTPS2-membrane-bound transcription factor peptidase, site 2 Gene |
| Size: | 2ug |
| Accessions: | BC036465 |
| Gene id: | 51360 |
| Gene description: | membrane-bound transcription factor peptidase, site 2 |
| Synonyms: | BRESEK; IFAP; KFSD; KFSDX; OLMSX; S2P; membrane-bound transcription factor site-2 protease; SREBPs intramembrane protease; endopeptidase S2P; keratosis follicularis spinulosa decalvans; membrane-bound transcription factor protease, site 2; site-2 protease; sterol regulatory element-binding proteins intramembrane protease; membrane bound transcription factor peptidase, site 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgattccggtgtcgctggtggtggtggtggtgggtggctggactgtcgtctacctgaccgacttggtgctggagtcatctgtctattttaaacattcttatgaagactggctggaaaacaacggactgagcatctcccctttccacataagatggcaaactgctgttttcaatcgtgccttttacagttggggacggcggaaagcaaggatgctttaccagtggttcaattttggaatggtgtttggcgtaattgccatgtttagctcattttttctccttggaaaaacgctgatgcagactttggcacaaatgatggctgactctccctcttcttattcttcctcctcttcttcctcttcctcctcttcttcctcttcctcttcttcatcttcttcctcttcctcgcttcacaatgaacaggtgttacaagttgtggttcctggtataaatttacccgtcaatcaactgacctatttcttcacggcagttctcattagtggtgttgtacatgaaattggacatgggatagcagctattagggaacaagttcgatttaatggctttgggatttttctcttcattatttatcctggagcatttgttgatctgttcaccactcatttgcaacttatatcgccagtccagcagctaaggatattttgtgcaggtatctggcataattttgtccttgcactcttgggtattttagctcttgttctcctcccagtaattctcttgccattttactacactggagttggggtgctcatcactgaagttgctgaggactctcctgccattggacccagaggcctttttgtgggagaccttgtcacccatctacaggattgtcctgttactaatgtgcaagattggaatgaatgtttagataccatcgcctatgagccccaaattggttactgtataagtgcatcaactttacagcagttaagtttcccagttagaggtgtgtatatttcctcaatataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - GATA binding protein 1 (globin transcription factor 1) - SAM pointed domain containing ets transcription factor - DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae) - proteasome (prosome, macropain) 26S subunit, ATPase, 4 |