Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GATA1-GATA binding protein 1 (globin transcription factor 1) Gene
PTXBC009797
New product
Data sheet of GATA1-GATA binding protein 1 (globin transcription factor 1) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GATA1-GATA binding protein 1 (globin transcription factor 1) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009797 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GATA1 |
| Origin species: | Human |
| Product name: | GATA1-GATA binding protein 1 (globin transcription factor 1) Gene |
| Size: | 2ug |
| Accessions: | BC009797 |
| Gene id: | 2623 |
| Gene description: | GATA binding protein 1 (globin transcription factor 1) |
| Synonyms: | transcription factor GATA1; ERYF1; GF-1; GF1; NF-E1; NFE1; XLANP; XLTDA; XLTT; erythroid transcription factor; GATA-binding factor 1; NF-E1 DNA-binding protein; erythroid transcription factor 1; globin transcription factor 1; nuclear factor, erythroid 1; GATA binding protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagttccctggcctggggtccctggggacctcagagcccctcccccagtttgtggatcctgctctggtgtcctccacaccagaatcaggggttttcttcccctctgggcctgagggcttggatgcagcagcttcctccactgccccgagcacagccaccgctgcagctgcggcactggcctactacagggacgctgaggcctacagacactccccagtctttcaggtgtacccattgctcaactgtatggaggggatcccagggggctcaccatatgccggctgggcctacggcaagacggggctctaccctgcctcaactgtgtgtcccacccgcgaggactctcctccccaggccgtggaagatctggatggaaaaggcagcaccagcttcctggagactttgaagacagagcggctgagcccagacctcctgaccctgggacctgcactgccttcatcactccctgtccccaatagtgcttatgggggccctgacttttccagtaccttcttttctcccaccgggagccccctcaattcagcagcctattcctctcccaagcttcgtggaactctccccctgcctccctgtgaggccagggagtgtgtgaactgcggagcaacagccactccactgtggcggagggacaggacaggccactacctatgcaacgcctgcggcctctatcacaagatgaatgggcagaacaggcccctcatccggcccaagaagcgcctgattgtcagtaaacgggcaggtactcagtgcaccaactgccagacgaccaccacgacactgtggcggagaaatgccagtggggatcccgtgtgcaatgcctgcggcctctactacaagctacaccaccagcactactgtggtggctccgctcagctcatgagggcacagagcatggcctccagaggaggggtggtgtccttctcctcttgtagccagaattctggacaacccaagtctctgggccccaggcaccccctggcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SAM pointed domain containing ets transcription factor - DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae) - proteasome (prosome, macropain) 26S subunit, ATPase, 4 - proteasome (prosome, macropain) 26S subunit, ATPase, 2 |