GATA1-GATA binding protein 1 (globin transcription factor 1) Gene View larger

GATA1-GATA binding protein 1 (globin transcription factor 1) Gene

PTXBC009797

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GATA1-GATA binding protein 1 (globin transcription factor 1) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GATA1-GATA binding protein 1 (globin transcription factor 1) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009797
Product type: DNA & cDNA
Ncbi symbol: GATA1
Origin species: Human
Product name: GATA1-GATA binding protein 1 (globin transcription factor 1) Gene
Size: 2ug
Accessions: BC009797
Gene id: 2623
Gene description: GATA binding protein 1 (globin transcription factor 1)
Synonyms: transcription factor GATA1; ERYF1; GF-1; GF1; NF-E1; NFE1; XLANP; XLTDA; XLTT; erythroid transcription factor; GATA-binding factor 1; NF-E1 DNA-binding protein; erythroid transcription factor 1; globin transcription factor 1; nuclear factor, erythroid 1; GATA binding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagttccctggcctggggtccctggggacctcagagcccctcccccagtttgtggatcctgctctggtgtcctccacaccagaatcaggggttttcttcccctctgggcctgagggcttggatgcagcagcttcctccactgccccgagcacagccaccgctgcagctgcggcactggcctactacagggacgctgaggcctacagacactccccagtctttcaggtgtacccattgctcaactgtatggaggggatcccagggggctcaccatatgccggctgggcctacggcaagacggggctctaccctgcctcaactgtgtgtcccacccgcgaggactctcctccccaggccgtggaagatctggatggaaaaggcagcaccagcttcctggagactttgaagacagagcggctgagcccagacctcctgaccctgggacctgcactgccttcatcactccctgtccccaatagtgcttatgggggccctgacttttccagtaccttcttttctcccaccgggagccccctcaattcagcagcctattcctctcccaagcttcgtggaactctccccctgcctccctgtgaggccagggagtgtgtgaactgcggagcaacagccactccactgtggcggagggacaggacaggccactacctatgcaacgcctgcggcctctatcacaagatgaatgggcagaacaggcccctcatccggcccaagaagcgcctgattgtcagtaaacgggcaggtactcagtgcaccaactgccagacgaccaccacgacactgtggcggagaaatgccagtggggatcccgtgtgcaatgcctgcggcctctactacaagctacaccaccagcactactgtggtggctccgctcagctcatgagggcacagagcatggcctccagaggaggggtggtgtccttctcctcttgtagccagaattctggacaacccaagtctctgggccccaggcaccccctggcttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SAM pointed domain containing ets transcription factor
- DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae)
- proteasome (prosome, macropain) 26S subunit, ATPase, 4
- proteasome (prosome, macropain) 26S subunit, ATPase, 2

Buy GATA1-GATA binding protein 1 (globin transcription factor 1) Gene now

Add to cart