Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GZMB-granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1) Gene
PTXBC030195
New product
Data sheet of GZMB-granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GZMB-granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030195 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GZMB |
| Origin species: | Human |
| Product name: | GZMB-granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1) Gene |
| Size: | 2ug |
| Accessions: | BC030195 |
| Gene id: | 3002 |
| Gene description: | granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1) |
| Synonyms: | C11; CCPI; CGL-1; CGL1; CSP-B; CSPB; CTLA1; CTSGL1; HLP; SECT; T-cell serine protease 1-3E; cathepsin G-like 1; cytotoxic T-lymphocyte proteinase 2; cytotoxic serine protease B; fragmentin 2; granzyme B (granzyme 2, cytotoxic T-lymphocyte-associated serine esterase 1); human lymphocyte protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcaaccaatcctgcttctgctggccttcctcctgctgcccagggcagatgcaggggagatcatcgggggacatgaggccaagccccactcccgcccctacatggcttatcttatgatctgggatcagaagtctctgaagaggtgcggtggcttcctgatacaagacgacttcgtgctgacagctgctcactgttggggaagctccataaatgtcaccttgggggcccacaatatcaaagaacaggagccgacccagcagtttatccctgtgaaaagacccatcccccatccagcctataatcctaagaacttctccaacgacatcatgctactgcagctggagagaaaggccaagcggaccagagctgtgcagcccctcaggctacctagcaacaaggcccaggtgaagccagggcagacatgcagtgtggccggctgggggcagacggcccccctgggaaaacactcacacacactacaagaggtgaagatgacagtgcaggaagatcgaaagtgcgaatctgacttacgccattattacgacagtaccattgagttgtgcgtgggggacccagagattaaaaagacttcctttaagggggactctggaggccctcttgtgtgtaacaaggtggcccagggcattgtctcctatggacgaaacaatggcatgcctccacgagcctgcaccaaagtctcaagctttgtacactggataaagaaaaccatgaaacgccactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) - inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma - non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase) - ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) |