Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ELAVL1-ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) Gene
PTXBC003376
New product
Data sheet of ELAVL1-ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ELAVL1-ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003376 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ELAVL1 |
| Origin species: | Human |
| Product name: | ELAVL1-ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) Gene |
| Size: | 2ug |
| Accessions: | BC003376 |
| Gene id: | 1994 |
| Gene description: | ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) |
| Synonyms: | ELAV1; Hua; MelG; ELAV-like protein 1; ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R); Hu antigen R; embryonic lethal, abnormal vision, drosophila, homolog-like 1; hu-antigen R; ELAV like RNA binding protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctaatggttatgaagaccacatggccgaagactgcaggggtgacatcgggagaacgaatttgatcgtcaactacctccctcagaacatgacccaggatgagttacgaagcctgttcagcagcattggtgaagttgaatctgcaaaacttattcgggataaagtagcaggacacagcttgggctatggctttgtgaactacgtgaccgcgaaggatgcagagagagcgatcaacacgctgaacggcttgaggctccagtcaaaaaccattaaggtgtcgtatgctcgcccgagctcagaggtgatcaaagacgccaacttgtacatcagcgggctcccgcggaccatgacccagaaggacgtagaagacatgttctctcggtttgggcggatcatcaactcgcgggtcctcgtggatcagactacaggtttgtccagaggggttgcgtttatccggtttgacaaacggtcggaggcagaagaggcaattaccagtttcaatggtcataaacccccaggttcctctgagcccatcacagtgaagtttgcagccaaccccaaccagaacaaaaacgtggcactcctctcgcagctgtaccactcgccagcgcgacggttcggaggccccgttcaccaccaggcgcagagattcaggttctcccccatgggcgtcgatcacatgagcgggctctctggcgtcaacgtgccaggaaacgcctcctccggctggtgcattttcatctacaacctggggcaggatgccgacgaggggatcctctggcagatgtttgggccgtttggtgccgtcaccaatgtgaaagtgatccgcgacttcaacaccaacaagtgcaaagggtttggctttgtgaccatgacaaactatgaagaagccgcgatggccatagccagcctgaacggctaccgcctgggggacaaaatcttacaggtttccttcaaaaccaacaagtcccacaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) - CD55 molecule, decay accelerating factor for complement (Cromer blood group) - amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4 - mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase |