Login to display prices
Login to display prices
ELAVL1-ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) Gene View larger

ELAVL1-ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ELAVL1-ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ELAVL1-ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003376
Product type: DNA & cDNA
Ncbi symbol: ELAVL1
Origin species: Human
Product name: ELAVL1-ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) Gene
Size: 2ug
Accessions: BC003376
Gene id: 1994
Gene description: ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)
Synonyms: ELAV1; Hua; MelG; ELAV-like protein 1; ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R); Hu antigen R; embryonic lethal, abnormal vision, drosophila, homolog-like 1; hu-antigen R; ELAV like RNA binding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctaatggttatgaagaccacatggccgaagactgcaggggtgacatcgggagaacgaatttgatcgtcaactacctccctcagaacatgacccaggatgagttacgaagcctgttcagcagcattggtgaagttgaatctgcaaaacttattcgggataaagtagcaggacacagcttgggctatggctttgtgaactacgtgaccgcgaaggatgcagagagagcgatcaacacgctgaacggcttgaggctccagtcaaaaaccattaaggtgtcgtatgctcgcccgagctcagaggtgatcaaagacgccaacttgtacatcagcgggctcccgcggaccatgacccagaaggacgtagaagacatgttctctcggtttgggcggatcatcaactcgcgggtcctcgtggatcagactacaggtttgtccagaggggttgcgtttatccggtttgacaaacggtcggaggcagaagaggcaattaccagtttcaatggtcataaacccccaggttcctctgagcccatcacagtgaagtttgcagccaaccccaaccagaacaaaaacgtggcactcctctcgcagctgtaccactcgccagcgcgacggttcggaggccccgttcaccaccaggcgcagagattcaggttctcccccatgggcgtcgatcacatgagcgggctctctggcgtcaacgtgccaggaaacgcctcctccggctggtgcattttcatctacaacctggggcaggatgccgacgaggggatcctctggcagatgtttgggccgtttggtgccgtcaccaatgtgaaagtgatccgcgacttcaacaccaacaagtgcaaagggtttggctttgtgaccatgacaaactatgaagaagccgcgatggccatagccagcctgaacggctaccgcctgggggacaaaatcttacaggtttccttcaaaaccaacaagtcccacaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)
- CD55 molecule, decay accelerating factor for complement (Cromer blood group)
- amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4
- mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase