Login to display prices
Login to display prices
ALS2CR4-amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4 Gene View larger

ALS2CR4-amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4 Gene

PTXBC029611

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ALS2CR4-amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ALS2CR4-amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4 Gene

Proteogenix catalog: PTXBC029611
Ncbi symbol: ALS2CR4
Product name: ALS2CR4-amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4 Gene
Size: 2ug
Accessions: BC029611
Gene id: 65062
Gene description: amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4
Synonyms: ALS2CR4; JBTS14; transmembrane protein 237; amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4; amyotrophic lateral sclerosis 2 chromosomal region candidate gene 4 protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggaagaatcctgtgcgtcctccacgagctattccacctgtgccaagtcaagatgatattccacttagtcgtcctaagaaaaagaagcccagaacaaaaaacacaccagcaagtgcttctttggaaggccttgctcagactgctggtcgaaggccctctgagggcaatgagccatcaactaaagaactcaaagagcacccagaggctcctgttcaaagaagacagaaaaagacaaggctacctcttgaattggagacttcctccacccaaaagaagtcatctagttcatctttattacgaaatgaaaatggtattgatgcggagcaagctgaggaggcagttattcaaaaacctcggaggaagacaaagaaaacccagccagcagaattacagtatgccaatgagctaggagtagaagatgaagacataatcactgatgagcaaactactgtggaacagcagtctgtattcactgcacccactggcattagccagcctgtaggcaaagtatttgtggaaaaaagccggagattccaggctgctgatcgttcagagttgataaagaccacagaaaacatagatgtgtcaatggacgtgaagccttcctggaccaccatagatgtggcacttacagtgcaccgggctttcaggatgattggtctcttttctcatggattcttggctggctgtgctgtgtggaatattgttgtgatatatgttctagcaggagatcagctatccaacctctcaaacattctgcaacaatacaagaccctagcgtatccattccagagtcttctgtacttgcttttggctctgagtacaatttcagcttttgacaggattgactttgctaaaatatcagtagcaatccgaaattttttggccctggatcctacagctttagcatctttcttgtactttactgctcttatactatctctgagtcagcaaatgacaagtgacagaatccacctttacacaccttcttctgttaatggtagcctctgggaagcaggaattgaggaacagattctccagccatggattgtggtgaatctcgtggtggctcttctggttggattatcttggctatttttgtcttataggccaggcatggatcttagtgaagagttaatgttctcctcagaggtggaagaatatcctgataaagagaaagaaatcaaagcctcttcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: