Login to display prices
Login to display prices
MGAT1-mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase Gene View larger

MGAT1-mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase Gene

PTXBC003575

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGAT1-mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MGAT1-mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase Gene

Proteogenix catalog: PTXBC003575
Ncbi symbol: MGAT1
Product name: MGAT1-mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase Gene
Size: 2ug
Accessions: BC003575
Gene id: 4245
Gene description: mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
Synonyms: GLCNAC-TI; GLCT1; GLYT1; GNT-1; GNT-I; GnTI; MGAT; alpha-1,3-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferase; N-glycosyl-oligosaccharide-glycoprotein N-acetylglucosaminyltransferase I; glcNAc-T I; mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgaagaagcagtctgcagggcttgtgctgtggggcgctatcctctttgtggcctggaatgccctgctgctcctcttcttctggacgcgcccagcacctggcaggccaccctcagtcagcgctctcgatggcgaccccgccagcctcacccgggaagtgattcgcctggcccaagacgccgaggtggagctggagcggcagcgtgggctgctgcagcagatcggggatgccctgtcgagccagcgggggagggtgcccaccgcggcccctcccgcccagccgcgtgtgcctgtgacccccgcgccggcggtgattcccatcctggtcatcgcctgtgaccgcagcactgttcggcgctgcctggacaagctgctgcattatcggccctcggctgagctcttccccatcatcgttagccaggactgcgggcacgaggagacggcccaggccatcgcctcctacggcagcgcggtcacgcacatccggcagcccgacctgagcagcattgcggtgccgccggaccaccgcaagttccagggctactacaagatcgcgcgccactaccgctgggcgctgggccaggtcttccggcagtttcgcttccccgcggccgtggtggtggaggatgacctggaggtggccccggacttcttcgagtactttcgggccacctatccgctgctgaaggccgacccctccctgtggtgcgtctcggcctggaatgacaacggcaaggagcagatggtggacgccagcaggcctgagctgctctaccgcaccgactttttccctggcctgggctggctgctgttggccgagctctgggctgagctggagcccaagtggccaaaggccttctgggacgactggatgcggcggccggagcagcggcaggggcgggcctgcatacgccctgagatctcaagaacgatgacctttggccgcaagggtgtgagccacgggcagttctttgaccagcacctcaagtttatcaagctgaaccagcagtttgtgcacttcacccagctggacctgtcttacctgcagcgggaggcctatgaccgagatttcctcgcccgcgtctacggtgctccccagctgcaggtggagaaagtgaggaccaatgaccggaaggagctgggggaggtgcgggtgcagtatacgggcagggacagcttcaaggctttcgccaaggctctgggtgtcatggatgaccttaagtcgggggttccgagagctggctaccggggtattgtcaccttccagttccggggccgccgtgtccacctggcgcccccaccgacgtgggagggctatgatcctagctggaattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: