Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
IKBKG-inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma Gene
PTXBC000299
New product
Data sheet of IKBKG-inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IKBKG-inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000299 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IKBKG |
| Origin species: | Human |
| Product name: | IKBKG-inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma Gene |
| Size: | 2ug |
| Accessions: | BC000299 |
| Gene id: | 8517 |
| Gene description: | inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma |
| Synonyms: | AMCBX1; FIP-3; FIP3; Fip3p; IKK-gamma; IKKAP1; IKKG; IMD33; IP1; IP2; IPD2; NEMO; ZC2HC9; NF-kappa-B essential modulator; I-kappa-B kinase subunit gamma; NF-kappa-B essential modifier; ikB kinase subunit gamma; ikB kinase-associated protein 1; incontinentia pigmenti; inhibitor of nuclear factor kappa-B kinase subunit gamma; inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaataggcacctctggaagagccaactgtgtgagatggtgcagcccagtggtggcccggcagcagatcaggacgtactgggcgaagagtctcctctggggaagccagccatgctgcacctgccttcagaacagggcgctcctgagaccctccagcgctgcctggaggagaatcaagagctccgagatgccatccggcagagcaaccagattctgcgggagcgctgcgaggagcttctgcatttccaagccagccagagggaggagaaggagttcctcatgtgcaagttccaggaggccaggaaactggtggagagactcggcctggagaagctcgatctgaagaggcagaaggagcaggctctgcgggaggtggagcacctgaagagatgccagcagcagatggctgaggacaaggcctctgtgaaagcccaggtgacgtccttgctcggggagctgcaggagagccagagtcgcttggaggctgccactaaggaatgccaggctctggagggtcgggcccgggcggccagcgagcaggcgcggcagctggagagtgagcgcgaggcgctgcagcagcagcacagcgtgcaggtggaccagctgcgcatgcagggccagagcgtggaggccgcgctccgcatggagcgccaggccgcctcggaggagaagaggaagctggcccagttgcaggtggcctatcaccagctcttccaagaatacgacaaccacatcaagagcagcgtggtgggcagtgagcggaagcgaggaatgcagctggaagatctcaaacagcagctccagcaggccgaggaggccctggtggccaaacaggaggtgatcgataagctgaaggaggaggccgagcagcacaagattgtgatggagaccgttccggtgctgaaggcccaggcggatatctacaaggcggacttccaggctgagaggcaggcccgggagaagctggccgagaagaaggagctcctgcaggagcagctggagcagctgcagagggagtacagcaaactgaaggccagctgtcaggagtcggccaggatcgaggacatgaggaagcggcatgtcgaggtctcccaggcccccttgccccccgcccctgcctacctctcctctcccctggccctgcccagccagaggaggagcccccccgaggagccacctgacttctgctgtcccaagtgccagtatcaggcccctgatatggacaccctgcagatacatgtcatggagtgcattgagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase) - ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) - ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) - CD55 molecule, decay accelerating factor for complement (Cromer blood group) |