IKBKG-inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma Gene View larger

IKBKG-inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma Gene

PTXBC000299

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IKBKG-inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IKBKG-inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000299
Product type: DNA & cDNA
Ncbi symbol: IKBKG
Origin species: Human
Product name: IKBKG-inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma Gene
Size: 2ug
Accessions: BC000299
Gene id: 8517
Gene description: inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma
Synonyms: AMCBX1; FIP-3; FIP3; Fip3p; IKK-gamma; IKKAP1; IKKG; IMD33; IP1; IP2; IPD2; NEMO; ZC2HC9; NF-kappa-B essential modulator; I-kappa-B kinase subunit gamma; NF-kappa-B essential modifier; ikB kinase subunit gamma; ikB kinase-associated protein 1; incontinentia pigmenti; inhibitor of nuclear factor kappa-B kinase subunit gamma; inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaataggcacctctggaagagccaactgtgtgagatggtgcagcccagtggtggcccggcagcagatcaggacgtactgggcgaagagtctcctctggggaagccagccatgctgcacctgccttcagaacagggcgctcctgagaccctccagcgctgcctggaggagaatcaagagctccgagatgccatccggcagagcaaccagattctgcgggagcgctgcgaggagcttctgcatttccaagccagccagagggaggagaaggagttcctcatgtgcaagttccaggaggccaggaaactggtggagagactcggcctggagaagctcgatctgaagaggcagaaggagcaggctctgcgggaggtggagcacctgaagagatgccagcagcagatggctgaggacaaggcctctgtgaaagcccaggtgacgtccttgctcggggagctgcaggagagccagagtcgcttggaggctgccactaaggaatgccaggctctggagggtcgggcccgggcggccagcgagcaggcgcggcagctggagagtgagcgcgaggcgctgcagcagcagcacagcgtgcaggtggaccagctgcgcatgcagggccagagcgtggaggccgcgctccgcatggagcgccaggccgcctcggaggagaagaggaagctggcccagttgcaggtggcctatcaccagctcttccaagaatacgacaaccacatcaagagcagcgtggtgggcagtgagcggaagcgaggaatgcagctggaagatctcaaacagcagctccagcaggccgaggaggccctggtggccaaacaggaggtgatcgataagctgaaggaggaggccgagcagcacaagattgtgatggagaccgttccggtgctgaaggcccaggcggatatctacaaggcggacttccaggctgagaggcaggcccgggagaagctggccgagaagaaggagctcctgcaggagcagctggagcagctgcagagggagtacagcaaactgaaggccagctgtcaggagtcggccaggatcgaggacatgaggaagcggcatgtcgaggtctcccaggcccccttgccccccgcccctgcctacctctcctctcccctggccctgcccagccagaggaggagcccccccgaggagccacctgacttctgctgtcccaagtgccagtatcaggcccctgatatggacaccctgcagatacatgtcatggagtgcattgagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase)
- ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)
- ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)
- CD55 molecule, decay accelerating factor for complement (Cromer blood group)

Buy IKBKG-inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma Gene now

Add to cart