Login to display prices
Login to display prices
NME5-non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase) Gene View larger

NME5-non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase) Gene

PTXBC026182

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NME5-non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NME5-non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase) Gene

Proteogenix catalog: PTXBC026182
Ncbi symbol: NME5
Product name: NME5-non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase) Gene
Size: 2ug
Accessions: BC026182
Gene id: 8382
Gene description: non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase)
Synonyms: NM23-H5; NM23H5; RSPH23; nucleoside diphosphate kinase homolog 5; IPIA-beta; NDK-H 5; NDP kinase homolog 5; inhibitor of p53-induced apoptosis-beta; non-metastatic cells 5 protein expressed in; non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase); radial spoke 23 homolog; testis-specific nm23 homolog; NME/NM23 family member 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagatatcaatgcctccacctcagatatatgtagaaaaaactctggccattatcaaaccagatattgttgacaaagaggaggagatacaagatattattcttagatccggattcaccattgttcagagaagaaaactacgcctcagccctgagcaatgtagtaacttttatgtggaaaagtatggaaaaatgtttttccccaacttaacagcttacatgagttctggaccacttgtcgccatgatattagctagacataaagccatctcttattggttagaacttttgggaccaaataatagcttagtagcgaaggagacacatccagacagtctgagggcaatttatggcacagatgacctaaggaatgcacttcatgggagtaatgactttgctgctgcggaaagagaaatacgttttatgtttcctgaagtgattgttgagcccattccaattggacaagctgctaaggactatttaaatttacatataatgccaactctgcttgaaggactcacagagctttgtaagcaaaaaccagcagatcctttgatttggctagctgattggctgctgaaaaataatcctaacaaacccaaactttgtcaccatccaattgtagaagaaccttattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: