Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NME5-non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase) Gene
PTXBC026182
New product
Data sheet of NME5-non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NME5-non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC026182 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NME5 |
| Origin species: | Human |
| Product name: | NME5-non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase) Gene |
| Size: | 2ug |
| Accessions: | BC026182 |
| Gene id: | 8382 |
| Gene description: | non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase) |
| Synonyms: | NM23-H5; NM23H5; RSPH23; nucleoside diphosphate kinase homolog 5; IPIA-beta; NDK-H 5; NDP kinase homolog 5; inhibitor of p53-induced apoptosis-beta; non-metastatic cells 5 protein expressed in; non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase); radial spoke 23 homolog; testis-specific nm23 homolog; NME/NM23 family member 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagatatcaatgcctccacctcagatatatgtagaaaaaactctggccattatcaaaccagatattgttgacaaagaggaggagatacaagatattattcttagatccggattcaccattgttcagagaagaaaactacgcctcagccctgagcaatgtagtaacttttatgtggaaaagtatggaaaaatgtttttccccaacttaacagcttacatgagttctggaccacttgtcgccatgatattagctagacataaagccatctcttattggttagaacttttgggaccaaataatagcttagtagcgaaggagacacatccagacagtctgagggcaatttatggcacagatgacctaaggaatgcacttcatgggagtaatgactttgctgctgcggaaagagaaatacgttttatgtttcctgaagtgattgttgagcccattccaattggacaagctgctaaggactatttaaatttacatataatgccaactctgcttgaaggactcacagagctttgtaagcaaaaaccagcagatcctttgatttggctagctgattggctgctgaaaaataatcctaacaaacccaaactttgtcaccatccaattgtagaagaaccttattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) - ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) - CD55 molecule, decay accelerating factor for complement (Cromer blood group) - amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4 |