ELAVL4-ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) Gene View larger

ELAVL4-ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) Gene

PTXBC036071

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ELAVL4-ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ELAVL4-ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036071
Product type: DNA & cDNA
Ncbi symbol: ELAVL4
Origin species: Human
Product name: ELAVL4-ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) Gene
Size: 2ug
Accessions: BC036071
Gene id: 1996
Gene description: ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D)
Synonyms: HUD; PNEM; ELAV-like protein 4; ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D); ELAV like neuron-specific RNA binding protein 4; Hu antigen D; paraneoplastic encephalomyelitis antigen HuD; ELAV like RNA binding protein 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttatgataattagcaccatggagcctcaggtgtcaaatggtccgacatccaatacaagcaatggaccctccagcaacaacagaaactgtccttctcccatgcaaacaggggcaaccacagatgacagcaaaaccaacctcatcgtcaactatttaccccagaatatgacccaagaagaattcaggagtctcttcgggagcattggtgaaatagaatcctgcaaacttgtgagagacaaaattacaggacagagtttagggtatggatttgttaactatattgatccaaaggatgcagagaaagccatcaacactttaaatggactcagactccagaccaaaaccataaaggtctcatatgcccgtccgagctcagcctcaatcagggatgctaacctctatgttagcggccttcccaaaaccatgacccagaaggaactggagcaacttttctcgcaatacggccgtatcatcacctcacgaatcctggttggtcaagtcacaggagtgtccagaggggtgggattcatccgctttgataagaggattgaggcagaagaagccatcaaagggctgaatggccagaagcccagcggtgctacggaaccgattactgtgaagtttgccaacaaccccagccagaagtccagccaggccctgctctcccagctctaccagtcccctaaccggcgctacccaggtccacttcaccaccaggctcagaggttcaggctggacaatttgcttaatatggcctatggcgtaaagaggttctccccaattaccattgatggaatgacaagccttgtgggaatgaacatccctggtcacacaggaactgggtggtgcatctttgtctacaacctgtcccccgattccgatgagagtgtcctctggcagctctttggcccctttggagcagtgaacaacgtaaaggtgattcgtgacttcaacaccaacaagtgcaagggattcggctttgtcaccatgaccaactatgatgaggcggccatggccatcaccagcctcaacgggtaccgcctgggagacagagtgttgcaagtttcctttaaaaccaacaaagcccacaagtcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma
- non-metastatic cells 5, protein expressed in (nucleoside-diphosphate kinase)
- ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R)
- ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)

Buy ELAVL4-ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) Gene now

Add to cart