Login to display prices
Login to display prices
ELAVL4-ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) Gene View larger

ELAVL4-ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) Gene

PTXBC036071

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ELAVL4-ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ELAVL4-ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) Gene

Proteogenix catalog: PTXBC036071
Ncbi symbol: ELAVL4
Product name: ELAVL4-ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) Gene
Size: 2ug
Accessions: BC036071
Gene id: 1996
Gene description: ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D)
Synonyms: HUD; PNEM; ELAV-like protein 4; ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D); ELAV like neuron-specific RNA binding protein 4; Hu antigen D; paraneoplastic encephalomyelitis antigen HuD; ELAV like RNA binding protein 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggttatgataattagcaccatggagcctcaggtgtcaaatggtccgacatccaatacaagcaatggaccctccagcaacaacagaaactgtccttctcccatgcaaacaggggcaaccacagatgacagcaaaaccaacctcatcgtcaactatttaccccagaatatgacccaagaagaattcaggagtctcttcgggagcattggtgaaatagaatcctgcaaacttgtgagagacaaaattacaggacagagtttagggtatggatttgttaactatattgatccaaaggatgcagagaaagccatcaacactttaaatggactcagactccagaccaaaaccataaaggtctcatatgcccgtccgagctcagcctcaatcagggatgctaacctctatgttagcggccttcccaaaaccatgacccagaaggaactggagcaacttttctcgcaatacggccgtatcatcacctcacgaatcctggttggtcaagtcacaggagtgtccagaggggtgggattcatccgctttgataagaggattgaggcagaagaagccatcaaagggctgaatggccagaagcccagcggtgctacggaaccgattactgtgaagtttgccaacaaccccagccagaagtccagccaggccctgctctcccagctctaccagtcccctaaccggcgctacccaggtccacttcaccaccaggctcagaggttcaggctggacaatttgcttaatatggcctatggcgtaaagaggttctccccaattaccattgatggaatgacaagccttgtgggaatgaacatccctggtcacacaggaactgggtggtgcatctttgtctacaacctgtcccccgattccgatgagagtgtcctctggcagctctttggcccctttggagcagtgaacaacgtaaaggtgattcgtgacttcaacaccaacaagtgcaagggattcggctttgtcaccatgaccaactatgatgaggcggccatggccatcaccagcctcaacgggtaccgcctgggagacagagtgttgcaagtttcctttaaaaccaacaaagcccacaagtcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: