SCNM1-sodium channel modifier 1 Gene View larger

SCNM1-sodium channel modifier 1 Gene

PTXBC000264

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SCNM1-sodium channel modifier 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SCNM1-sodium channel modifier 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000264
Product type: DNA & cDNA
Ncbi symbol: SCNM1
Origin species: Human
Product name: SCNM1-sodium channel modifier 1 Gene
Size: 2ug
Accessions: BC000264
Gene id: 79005
Gene description: sodium channel modifier 1
Synonyms: sodium channel modifier 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctttcaagagggaaggagacgattggagtcaactcaatgtgctcaaaaaaagaagagtcggggacctcctagccagttacattccagaggatgaggcgctgatgcttcgggatggacgctttgcttgtgccatctgcccccatcgaccggtactggacaccctggccatgctgactgcccaccgtgcaggcaagaaacatctgtccagcttgcagcttttctatggcaagaagcagccgggaaaggaaagaaagcagaatccaaaacatcagaatgaattgagaagggaagaaaccaaagctgaggctcctctgctaactcagacacgacttatcacccagagtgctctgcacagagctccccactataacagttgctgccgccggaagtacagaccagaagcccctggtccctctgtctccctttcccctatgccaccctcagaggtcaaactccaaagtgggaagatcagtagggaacctgaacctgcggctggcccacaggccgaggagtcagcaactgtctcagcccctgcacccatgagccccacaagaagacgagccctggaccattatctcacccttcgaagctctggatggatcccagatggacgaggtcgatgggtaaaagatgaaaatgttgagtttgactctgatgaggaggaaccacctgatctccccttggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - thymidine kinase 1, soluble
- Ras-related GTP binding D
- chymotrypsin C (caldecrin)
- methyltransferase like 1

Buy SCNM1-sodium channel modifier 1 Gene now

Add to cart