Login to display prices
Login to display prices
RRAGD-Ras-related GTP binding D Gene View larger

RRAGD-Ras-related GTP binding D Gene

PTXBC003088

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RRAGD-Ras-related GTP binding D Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RRAGD-Ras-related GTP binding D Gene

Proteogenix catalog: PTXBC003088
Ncbi symbol: RRAGD
Product name: RRAGD-Ras-related GTP binding D Gene
Size: 2ug
Accessions: BC003088
Gene id: 58528
Gene description: Ras-related GTP binding D
Synonyms: RAGD; bA11D8.2.1; ras-related GTP-binding protein D; Rag D protein; Ras related GTP binding D
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagccctggccaggctccacctcacggtgaccagggcctacaaagtgaatactgacatcaacttcgaggtgtttattcataaagtggatggtctgtcagatgaccacaaaattgaaacccaaagagatattcaccagagggcaaacgatgaccttgcagatgctggattagaaaaaattcacctcagcttttatctgacaagcatatatgatcattcaatatttgaagcttttagcaaagttgttcagaaactgattccacaactcccaactctggagaatttgctgaacatctttatctcaaattctggaattgaaaaggcatttctatttgatgtggtcagtaaaatttatattgcaactgatagtactccggtggatatgcaaacctatgagctctgctgtgatatgatagatgtggttattgacatctcttgtatttatggtctcaaagaagatggagcaggaaccccctatgacaaggaatccacagccatcataaagcttaataatacaaccgtgctttatttaaaagaggtgacaaagttcctggctctcgtttgctttgtcagagaggaaagctttgaaagaaaagggctaattgactataattttcattgcttccggaaggccattcatgaagtttttgaggtgagaatgaaagtagtaaaatctcgaaaggttcagaatcggctgcagaagaaaaagagagccacccctaatgggacccctagagtgctgctgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: