RRAGD-Ras-related GTP binding D Gene View larger

RRAGD-Ras-related GTP binding D Gene

PTXBC003088

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RRAGD-Ras-related GTP binding D Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RRAGD-Ras-related GTP binding D Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003088
Product type: DNA & cDNA
Ncbi symbol: RRAGD
Origin species: Human
Product name: RRAGD-Ras-related GTP binding D Gene
Size: 2ug
Accessions: BC003088
Gene id: 58528
Gene description: Ras-related GTP binding D
Synonyms: RAGD; bA11D8.2.1; ras-related GTP-binding protein D; Rag D protein; Ras related GTP binding D
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagccctggccaggctccacctcacggtgaccagggcctacaaagtgaatactgacatcaacttcgaggtgtttattcataaagtggatggtctgtcagatgaccacaaaattgaaacccaaagagatattcaccagagggcaaacgatgaccttgcagatgctggattagaaaaaattcacctcagcttttatctgacaagcatatatgatcattcaatatttgaagcttttagcaaagttgttcagaaactgattccacaactcccaactctggagaatttgctgaacatctttatctcaaattctggaattgaaaaggcatttctatttgatgtggtcagtaaaatttatattgcaactgatagtactccggtggatatgcaaacctatgagctctgctgtgatatgatagatgtggttattgacatctcttgtatttatggtctcaaagaagatggagcaggaaccccctatgacaaggaatccacagccatcataaagcttaataatacaaccgtgctttatttaaaagaggtgacaaagttcctggctctcgtttgctttgtcagagaggaaagctttgaaagaaaagggctaattgactataattttcattgcttccggaaggccattcatgaagtttttgaggtgagaatgaaagtagtaaaatctcgaaaggttcagaatcggctgcagaagaaaaagagagccacccctaatgggacccctagagtgctgctgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chymotrypsin C (caldecrin)
- methyltransferase like 1
- PIH1 domain containing 1
- transmembrane protein 18

Buy RRAGD-Ras-related GTP binding D Gene now

Add to cart