Login to display prices
Login to display prices
CTRC-chymotrypsin C (caldecrin) Gene View larger

CTRC-chymotrypsin C (caldecrin) Gene

PTXBC015118

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CTRC-chymotrypsin C (caldecrin) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CTRC-chymotrypsin C (caldecrin) Gene

Proteogenix catalog: PTXBC015118
Ncbi symbol: CTRC
Product name: CTRC-chymotrypsin C (caldecrin) Gene
Size: 2ug
Accessions: BC015118
Gene id: 11330
Gene description: chymotrypsin C (caldecrin)
Synonyms: CLCR; ELA4; chymotrypsin-C; elastase 4; elastase IV; serum calcium decreasing factor; chymotrypsin C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgggcatcactgtcctcgctgcgctcttggcctgtgcctccagctgtggggtgcccagcttcccgcccaacctatccgcccgagtggtgggaggagaggatgcccggccccacagctggccctggcagatctccctccagtacctcaagaacgacacgtggaggcatacgtgtggcgggactttgattgctagcaacttcgtcctcactgccgcccactgcatcagcaacacccggacctaccgtgtggccgtgggaaagaacaacctggaggtggaagacgaagaaggatccctgtttgtgggtgtggacaccatccacgtccacaagagatggaatgccctcctgttgcgcaatgatattgccctcatcaagcttgcagagcatgtggagctgagtgacaccatccaggtggcctgcctgccagagaaggactccctgctccccaaggactacccctgctatgtcaccggctggggccgcctctggaccaacggccccattgctgataagctgcagcagggcctgcagcccgtggtggatcacgccacgtgctccaggattgactggtggggcttcagggtgaagaaaaccatggtgtgcgctgggggcgatggcgtcatctcagcctgcaatggggactccggtggcccactgaactgccagttggagaacggttcctgggaggtgtttggcatcgtcagctttggctcccggcggggctgcaacacccgcaagaagccggtagtctacacccgggtgtccgcctacatcgactggatcaacgagaaaatgcagctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: