Login to display prices
Login to display prices
METTL1-methyltransferase like 1 Gene View larger

METTL1-methyltransferase like 1 Gene

PTXBC000550

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of METTL1-methyltransferase like 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about METTL1-methyltransferase like 1 Gene

Proteogenix catalog: PTXBC000550
Ncbi symbol: METTL1
Product name: METTL1-methyltransferase like 1 Gene
Size: 2ug
Accessions: BC000550
Gene id: 4234
Gene description: methyltransferase like 1
Synonyms: C12orf1; TRM8; TRMT8; YDL201w; tRNA (guanine-N(7)-)-methyltransferase; D1075-like gene product; methyltransferase-like protein 1; tRNA (guanine(46)-N(7))-methyltransferase; tRNA(m7G46)-methyltransferase; methyltransferase like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagccgagactcggaacgtggccggagcagaggccccaccgccccagaagcgctactaccggcaacgtgctcactccaaccccatggcggaccacacgctgcgctaccctgtgaagccagaggagatggactggtctgagctatacccagagttcttcgctccactcactcaaaatcagagccacgatgacccaaaggataagaaagaaaagagagctcaggcccaagtggagtttgcagacataggctgtggctatggtggcctgttagtggaactgtcaccgctgttcccagacacacttattctgggtctggagatccgggtgaaggtctcagactatgtacaagaccggattcgggccctacgcgcagctcctgcaggtggcttccagaacatcgcctgtctccgtagcaatgccatgaagcaccttcctaacttcttctacaagggccagctgacaaagatgttcttcctcttccccgacccacatttcaagcggacaaagcacaagtggcgaatcatcagtcccaccctgctagcagaatatgcctacgtgctaagagttggggggctggtgtataccataaccgatgtgctggagctacacgactggatgtgcactcatttcgaagagcacccactgtttgagcgtgtgcctctggaggacctgagtgaagaccccgttgtgggacatctaggcacctcaactgaggaggggaagaaagttctacgtaatggagggaagaatttcccagccatcttccgaagaatacaagatcccgtcctccaggcagtgacctcccaaaccagcctgcctggtcactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: