TMEM59-transmembrane protein 59 Gene View larger

TMEM59-transmembrane protein 59 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM59-transmembrane protein 59 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM59-transmembrane protein 59 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016374
Product type: DNA & cDNA
Ncbi symbol: TMEM59
Origin species: Human
Product name: TMEM59-transmembrane protein 59 Gene
Size: 2ug
Accessions: BC016374
Gene id: 9528
Gene description: transmembrane protein 59
Synonyms: C1orf8; DCF1; HSPC001; PRO195; UNQ169; transmembrane protein 59; dendritic cell factor 1; liver membrane-bound protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgccgaaggggagcctctgggtgaggacccaactggggctcccgccgctgctgctgctgaccatggccttggccggaggttcggggaccgcttcggctgaagcatttgactcggtcttgggtgatacggcgtcttgccaccgggcctgtcagttgacctaccccttgcacacctaccctaaggaagaggagttgtacgcatgtcagagaggttgcaggctgttttcaatttgtcagtttgtggatgatggaattgacttaaatcgaactaaattggaatgtgaatctgcatgtacagaagcatattcccaatctgatgagcaatatgcttgccatcttggttgccagaatcagctgccattcgctgaactgagacaagaacaacttatgtccctgatgccaaaaatgcacctactctttcctctaactctggtgaggtcattctggagtgacatgatggactccgcacagagcttcataacctcttcatggactttttatcttcaagccgatgacggaaaaatagttatattccagtctaagccagaaatccagtacgcaccacatttggagcaggagcctacaaatttgagagaatcatctctaagcaaaatgtcctcagatctgcaaatgagaaattcacaagcgcacaggaattttcttgaagatggagaaagtgatggctttttaagatgcctctctcttaactctgggtggattttaactacaactcttgtcctctcggtgatggtattgctttggatttgttgtgcaactgttgctacagctgtggagcagtatgttccctctgagaagctgagtatctatggtgacttggagtttatgaatgaacaaaagctaaacagatatccagcttcttctcttgtggttgttagatctaaaactgaagatcatgaagaagcagggcctctacctacaaaagtgaatcttgctcattctgaaatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 42
- anthrax toxin receptor 1
- deoxyuridine triphosphatase
- lectin, mannose-binding 2

Buy TMEM59-transmembrane protein 59 Gene now

Add to cart