LMAN2-lectin, mannose-binding 2 Gene View larger

LMAN2-lectin, mannose-binding 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LMAN2-lectin, mannose-binding 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LMAN2-lectin, mannose-binding 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017263
Product type: DNA & cDNA
Ncbi symbol: LMAN2
Origin species: Human
Product name: LMAN2-lectin, mannose-binding 2 Gene
Size: 2ug
Accessions: BC017263
Gene id: 10960
Gene description: lectin, mannose-binding 2
Synonyms: C5orf8; GP36B; vesicular integral-membrane protein VIP36; glycoprotein GP36b; vesicular integral protein of 36 kDa; vesicular integral-membrane protein 36; lectin, mannose binding 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcggaaggctggatttggcgttggggctggggccggcggtgcctgggaaggcctgggcttctcggccccggccctggccccactacacctctctttcttcttttgttgttggggtctgtgactgcggatataactgacggcaacagtgaacatctcaagcgggagcattcgctcattaagccctaccaaggggtcggttccagctctatgcccctctgggacttccagggcagcactatgctcacgagccagtacgtacgtctgacccctgacgagcgcagcaaagagggctctatctggaaccaccagccgtgcttcctcaaagactgggaaatgcacgtccacttcaaagtccacggcacagggaagaagaacctccatggagacggcatcgccttgtggtacacccgggaccgcctcgtgccagggcctgtgtttggaagcaaagataacttccacggcttagccatcttcctggacacctaccccaatgatgagaccactgagcgcgtgttcccgtacatctcggtgatggtgaacaatggctccctgtcctacgaccacagcaaggatgggcgctggaccgagctggcgggctgcacggctgacttccgcaaccgcgatcacgacaccttcctggctgtgcgctactcccggggccgtctgacggtgatgaccgacctggaggacaagaacgagtggaagaactgcattgacatcacgggagtgcgcctgcccaccggctactacttcggggcctccgccggcaccggcgacctgtctgacaatcatgacatcatctccatgaagctgttccagctgatggtggagcacacgcccgacgaggagagcatcgactggaccaagatcgagcccagcgtcaacttcctcaagtcgcccaaagacaacgtggacgaccccacggggaacttccgcagcgggcccctgacggggtggcgggtgttcctgctgctgctgtgcgctctcctgggcatcgttgtctgcgccgtggtgggggccgtggtgttccagaagcggcaggagcggaacaagcgcttctactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NudC domain containing 3
- peptidylprolyl isomerase D
- actin-related protein T1
- actin-related protein T2

Buy LMAN2-lectin, mannose-binding 2 Gene now

Add to cart