ACTRT2-actin-related protein T2 Gene View larger

ACTRT2-actin-related protein T2 Gene

PTXBC029499

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACTRT2-actin-related protein T2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ACTRT2-actin-related protein T2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029499
Product type: DNA & cDNA
Ncbi symbol: ACTRT2
Origin species: Human
Product name: ACTRT2-actin-related protein T2 Gene
Size: 2ug
Accessions: BC029499
Gene id: 140625
Gene description: actin-related protein T2
Synonyms: ARPM2; ARPT2; Arp-T2; HARPM2; actin-related protein T2; actin-related protein M2; actin-related protein hArpM2; actin related protein T2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttaatccgcatgctttagactccccggctgtgatttttgacaatggctcggggttctgcaaagcgggcctgtctggggagtttggaccccggcacatggtcagctccatcgtggggcacctgaaattccaggctccctcagcagaggccaaccagaagtactttgtgggggaggaggccctgtacaagcaggaggccctgcagctgcactcccctttcgagcgtggcctgatcacagggtgggatgacgtggagagactctggaagcacctctttgagtgggagctaggcgtgaaacccagcgaccagcccctgcttgcaacggagccctccctgaaccccagggagaaccgtgagaagatggcagaagtcatgttcgagaacttcggcgtgcccgctttctacctgtcggaccaggcggtgctggctctctacgcctcggcctgtgtcacgggcctggtggtggacagcggggatgcggtcacctgcactgtccccatctttgagggttactccctgccccacgcagtcaccaagctccacgtggcgggcagggacatcacggagctcctcatgcagctgctcctggccagcggccacaccttcccctgccagctggacaagggtctcgtggacgacatcaaaaagaagctgtgctacgtggccttggagcccgagaaggagctttcccggaggccggaggaggtcctgagggagtacaagctgcccgacgggaacatcatcagcctcggggacccgctgcaccaggcgcccgaggccctgttcgtgccccagcagctgggcagccagagccccgggctctcgaatatggtctccagcagcatcaccaagtgtgataccgacatccagaagatcctctttggggagattgtgctgtcggggggcactaccctgttccacgggctggatgaccggcttctcaaggagctggagcagctggcctccaaggacacccccatcaagatcacggctccccccgaccggtggttctccacctggattggagcctccatcgtcacctctctgagtagcttcaagcagatgtgggtcaccgccgcagacttcaaggagtttgggacctccgtggtgcagagaagatgcttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 22
- SET domain, bifurcated 1
- transmembrane protein 43
- transmembrane protein 49

Buy ACTRT2-actin-related protein T2 Gene now

Add to cart