TMEM49-transmembrane protein 49 Gene View larger

TMEM49-transmembrane protein 49 Gene

PTXBC009758

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM49-transmembrane protein 49 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM49-transmembrane protein 49 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009758
Product type: DNA & cDNA
Ncbi symbol: TMEM49
Origin species: Human
Product name: TMEM49-transmembrane protein 49 Gene
Size: 2ug
Accessions: BC009758
Gene id: 81671
Gene description: transmembrane protein 49
Synonyms: TMEM49; EPG3; TANGO5; vacuole membrane protein 1; ectopic P-granules autophagy protein 3 homolog; transmembrane protein 49; transport and golgi organization 5 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagagaatggaaaaaattgtgaccagagacgtgtagcaatgaacaaggaacatcataatggaaatttcacagacccctcttcagtgaatgaaaagaagaggagggagcgggaagaaaggcagaatattgtcctgtggagacagccgctcattaccttgcagtatttttctctggaaatccttgtaatcttgaaggaatggacctcaaaattatggcatcgtcaaagcattgtggtgtcttttttactgctgcttgctgtgcttatagctacgtattatgttgaaggagtgcatcaacagtatgtgcaacgtatagagaaacagtttcttttgtatgcctactggataggcttaggaattttgtcttctgttgggcttggaacagggctgcacacctttctgctttatctgggtccacatatagcctcagttacattagctgcttatgaatgcaattcagttaattttcccgaaccaccctatcctgatcagattatttgtccagatgaagagggcactgaaggaaccatttctttgtggagtatcatctcaaaagttaggattgaagcctgcatgtggggtatcggtacagcaatcggagagctgcctccatatttcatggccagagcagctcgcctctcaggtgctgaaccagatgatgaagagtatcaggaatttgaagagatgctggaacatgcagagtctgcacaagactttgcctcccgggccaaactggcagttcaaaaactagtacagaaagttggattttttggaattttggcctgtgcttcaattccaaatcctttatttgatctggctggaataacgtgtggacactttctggtacctttttggaccttctttggtgcaaccctaattggaaaagcaataataaaaatgcatatccagaaaatttttgttataataacattcagcaagcacatagtggagcaaatggtggctttcattggtgctgtccccggcataggtccatctctgcagaagccatttcaggagtacctggaggctcaacggcagaagcttcaccacaaaagcgaaatgggcacaccacagggagaaaactggttgtcctggatgtttgaaaagttggtcgttgtcatggtgtgttacttcatcctatctatcattaactccatggcacaaagttatgccaaacgaatccagcagcggttgaactcagaggagaaaactaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Rh-associated glycoprotein
- centrosomal protein 72kDa
- ENTH domain containing 1
- E4F transcription factor 1

Buy TMEM49-transmembrane protein 49 Gene now

Add to cart