RHAG-Rh-associated glycoprotein Gene View larger

RHAG-Rh-associated glycoprotein Gene

PTXBC012605

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RHAG-Rh-associated glycoprotein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RHAG-Rh-associated glycoprotein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012605
Product type: DNA & cDNA
Ncbi symbol: RHAG
Origin species: Human
Product name: RHAG-Rh-associated glycoprotein Gene
Size: 2ug
Accessions: BC012605
Gene id: 6005
Gene description: Rh-associated glycoprotein
Synonyms: CD241; OHS; OHST; RH2; RH50A; Rh50; Rh50GP; SLC42A1; ammonium transporter Rh type A; Rh 50 glycoprotein; Rhesus associated polypeptide, 50-KD; Rhesus blood group-associated glycoprotein; erythrocyte membrane glycoprotein Rh50; erythrocyte plasma membrane 50 kDa glycoprotein; rh family type A glycoprotein; rh type A glycoprotein; rhesus blood group family type A glycoprotein; rhesus blood group-associated ammonia channel; truncated Rh-associated glycoprotein; Rh-associated glycoprotein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggttcacattccctctcatggctatagtcctggaaattgccatgattgttttatttggattatttgttgagtatgaaacggaccagactgttctcgagcagctcaacatcaccaagccaacagacatgggcatattctttgagttatatcctctgttccaagatgtacatgttatgatatttgttgggtttggcttcctcatgaccttcctgaagaaatatggcttcagcagtgtgggtatcaacctactcgttgctgctttgggcctccagtggggcactattgtacagggaaccctgcaaagccagggacagaaatttaacattggaatcaaaaacatgataaatgcagacttcagtgcagccacagttctgatatcttttggagctgtcctgggaaaaacgagccccacccaaatgctgatcatgacaattttagaaattgttttctttgcccacaatgaatacctggttagtgaaatatttaaggcctctgacattggagcatcaatgacgatccatgcctttggggcctactttggcttggctgtagcaggcatcttgtatcgatctggactgagaaaggggcgtgaaaatgaagagtccgcatactactcagacttgtttgcaatgattgggactctctttctgtggatgttttggcccagctttaactcggccattgctgaacctggagacaaacagtgcagggccattgtaaacacgtacttctctctcgctgcctgtgtgctcacagcctttgccttctccagcctagtggagcaccgaggcaagctcaacatggttcacattcagaatgccacccttgctggaggagttgctgtgggcacttgtgcggatatggcaattcacccatttggttctatgattattgggagcattgcaggaatggtctctgtgcttggatacaagttcctgactccactttttactactaaactgaggatccatgatacatgtggggtccataacctccacggcttacctggtgtagtgggaggccttgcaggcattgtggcagtagcaatgggcgcctccaacacgtctatggccatgcaggcagctgcactgggttcctctatcggaacagcagttgttggaggtctgatgacaggtttaattctaaagttgcctctctggggacagccatctgaccagaactgctatgatgattctgtttattggaaggtccctaagacgagataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - centrosomal protein 72kDa
- ENTH domain containing 1
- E4F transcription factor 1
- CDC42 small effector 1

Buy RHAG-Rh-associated glycoprotein Gene now

Add to cart