Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RHAG-Rh-associated glycoprotein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RHAG-Rh-associated glycoprotein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012605 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RHAG |
| Origin species: | Human |
| Product name: | RHAG-Rh-associated glycoprotein Gene |
| Size: | 2ug |
| Accessions: | BC012605 |
| Gene id: | 6005 |
| Gene description: | Rh-associated glycoprotein |
| Synonyms: | CD241; OHS; OHST; RH2; RH50A; Rh50; Rh50GP; SLC42A1; ammonium transporter Rh type A; Rh 50 glycoprotein; Rhesus associated polypeptide, 50-KD; Rhesus blood group-associated glycoprotein; erythrocyte membrane glycoprotein Rh50; erythrocyte plasma membrane 50 kDa glycoprotein; rh family type A glycoprotein; rh type A glycoprotein; rhesus blood group family type A glycoprotein; rhesus blood group-associated ammonia channel; truncated Rh-associated glycoprotein; Rh-associated glycoprotein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggttcacattccctctcatggctatagtcctggaaattgccatgattgttttatttggattatttgttgagtatgaaacggaccagactgttctcgagcagctcaacatcaccaagccaacagacatgggcatattctttgagttatatcctctgttccaagatgtacatgttatgatatttgttgggtttggcttcctcatgaccttcctgaagaaatatggcttcagcagtgtgggtatcaacctactcgttgctgctttgggcctccagtggggcactattgtacagggaaccctgcaaagccagggacagaaatttaacattggaatcaaaaacatgataaatgcagacttcagtgcagccacagttctgatatcttttggagctgtcctgggaaaaacgagccccacccaaatgctgatcatgacaattttagaaattgttttctttgcccacaatgaatacctggttagtgaaatatttaaggcctctgacattggagcatcaatgacgatccatgcctttggggcctactttggcttggctgtagcaggcatcttgtatcgatctggactgagaaaggggcgtgaaaatgaagagtccgcatactactcagacttgtttgcaatgattgggactctctttctgtggatgttttggcccagctttaactcggccattgctgaacctggagacaaacagtgcagggccattgtaaacacgtacttctctctcgctgcctgtgtgctcacagcctttgccttctccagcctagtggagcaccgaggcaagctcaacatggttcacattcagaatgccacccttgctggaggagttgctgtgggcacttgtgcggatatggcaattcacccatttggttctatgattattgggagcattgcaggaatggtctctgtgcttggatacaagttcctgactccactttttactactaaactgaggatccatgatacatgtggggtccataacctccacggcttacctggtgtagtgggaggccttgcaggcattgtggcagtagcaatgggcgcctccaacacgtctatggccatgcaggcagctgcactgggttcctctatcggaacagcagttgttggaggtctgatgacaggtttaattctaaagttgcctctctggggacagccatctgaccagaactgctatgatgattctgtttattggaaggtccctaagacgagataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - centrosomal protein 72kDa - ENTH domain containing 1 - E4F transcription factor 1 - CDC42 small effector 1 |