PPID-peptidylprolyl isomerase D Gene View larger

PPID-peptidylprolyl isomerase D Gene

PTXBC030707

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPID-peptidylprolyl isomerase D Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PPID-peptidylprolyl isomerase D Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030707
Product type: DNA & cDNA
Ncbi symbol: PPID
Origin species: Human
Product name: PPID-peptidylprolyl isomerase D Gene
Size: 2ug
Accessions: BC030707
Gene id: 5481
Gene description: peptidylprolyl isomerase D
Synonyms: CYP-40; CYPD; peptidyl-prolyl cis-trans isomerase D; 40 kDa peptidyl-prolyl cis-trans isomerase D; PPIase D; cyclophilin 40; cyclophilin D; cyclophilin-related protein; rotamase D; testicular tissue protein Li 147; peptidylprolyl isomerase D
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgcacccgtccccccaagccaagccctccaaccccagtaaccctcgagtcttctttgacgtggacatcggaggggagcgagttggtcgaattgtcttagaattgtttgcagatatcgtacccaaaactgcggaaaattttcgtgcactgtgtacaggagaaaaaggcattggacacacgactgggaaacctctccatttcaaaggatgcccttttcatcgaattattaagaaatttatgattcagggtggagacttctcaaatcagaatgggacaggtggagaaagtatttatggtgaaaaatttgaagatgaaaatttccattacaagcatgatcgggagggtttactgagcatggcaaatgcaggccgcaacacaaacggttctcagttttttatcacaacagttccaactcctcatttggatgggaaacatgtggtgtttggccaagtaattaaaggaataggagtggcaaggatattggaaaatgtggaagtgaaaggtgaaaaacctgctaaattgtgcgttattgcagaatgtggagaattgaaggaaggagatgacgggggaatattcccaaaagatggctctggcgacagtcatccagatttccctgaggatgcggatatagatttaaaagatgtagataaaattttattaataacagaagacttaaaaaacattggaaatacttttttcaaatcccagaactgggagatggctattaaaaaatatgcagaagttttaagatacgtggacagttcaaaggctgttattgagacagcagatagagccaagctgcaacctatagctttaagctgtgtactgaatattggtgcttgtaaactgaagatgtcaaattggcagggagcaattgacagttgtttagaggctcttgaactagacccatcaaataccaaagcattgtaccgcagagctcaaggatggcaaggattaaaagaatatgatcaagcattggctgatcttaagaaagctcaggggatagcaccagaagataaagctatccaggcagaattgctgaaagtcaaacaaaagataaaggcacagaaagataaagagaaggcagtatatgcaaaaatgtttgcttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - actin-related protein T1
- actin-related protein T2
- transmembrane protein 22
- SET domain, bifurcated 1

Buy PPID-peptidylprolyl isomerase D Gene now

Add to cart