ANTXR1-anthrax toxin receptor 1 Gene View larger

ANTXR1-anthrax toxin receptor 1 Gene

PTXBC012074

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ANTXR1-anthrax toxin receptor 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ANTXR1-anthrax toxin receptor 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012074
Product type: DNA & cDNA
Ncbi symbol: ANTXR1
Origin species: Human
Product name: ANTXR1-anthrax toxin receptor 1 Gene
Size: 2ug
Accessions: BC012074
Gene id: 84168
Gene description: anthrax toxin receptor 1
Synonyms: ATR; GAPO; TEM8; anthrax toxin receptor 1; 2310008J16Rik; 2810405N18Rik; tumor endothelial marker 8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccacggcggagcggagagccctcggcatcggcttccagtggctctctttggccactctggtgctcatctgcgccgggcaagggggacgcagggaggatgggggtccagcctgctacggcggatttgacctgtacttcattttggacaaatcaggaagtgtgctgcaccactggaatgaaatctattactttgtggaacagttggctcacaaattcatcagcccacagttgagaatgtcctttattgttttctccacccgaggaacaaccttaatgaaactgacagaagacagagaacaaatccgtcaaggcctagaagaactccagaaagttctgccaggaggagacacttacatgcatgaaggatttgaaagggccagtgagcagatttattatgaaaacagacaagggtacaggacagccagcgtcatcattgctttgactgatggagaactccatgaagatctctttttctattcagagagggaggctaataggtctcgagatcttggtgcaattgtttactgtgttggtgtgaaagatttcaatgagacacagctggcccggattgcggacagtaaggatcatgtgtttcccgtgaatgacggctttcaggctctgcaaggcatcatccactcaattttgaagaagtcctgcatcgaaattctagcagctgaaccatccaccatatgtgcaggagagtcatttcaagttgtcgtgagaggaaacggcttccgacatgcccgcaacgtggacagggtcctctgcagcttcaagatcaatgactcggtcacactcaatgagaagcccttttctgtggaagatacttatttactgtgtccagcgcctatcttaaaagaagttggcatgaaagctgcactccaggtcagcatgaacgatggcctctcttttatctccagttctgtcatcatcaccaccacacactgtagcctccacaaaattgcatcaggccccacaacagctgcttgcatggaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - deoxyuridine triphosphatase
- lectin, mannose-binding 2
- NudC domain containing 3
- peptidylprolyl isomerase D

Buy ANTXR1-anthrax toxin receptor 1 Gene now

Add to cart