TK1-thymidine kinase 1, soluble Gene View larger

TK1-thymidine kinase 1, soluble Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TK1-thymidine kinase 1, soluble Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TK1-thymidine kinase 1, soluble Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007986
Product type: DNA & cDNA
Ncbi symbol: TK1
Origin species: Human
Product name: TK1-thymidine kinase 1, soluble Gene
Size: 2ug
Accessions: BC007986
Gene id: 7083
Gene description: thymidine kinase 1, soluble
Synonyms: TK2; thymidine kinase, cytosolic; thymidine kinase 1 soluble isoform; thymidine kinase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagctgcattaacctgcccactgtgctgcctggctcccccagcaagacccgggggcagatccaggtgattctcgggccgatgttctcaggaaaaagcacagagttgatgagacgcgtccgtcgcttccagattgctcagtacaagtgcctggtgatcaagtatgccaaagacactcgctacagcagcagcttctgcacacatgaccggaacaccatggaggcactgcccgcctgcctgctccgagacgtggcccaggaggccctgggcgtggctgtcataggcatcgacgaggggcagtttttccctgacatcgtggagttctgcgaggccatggccaacgccgggaagaccgtaattgtggctgcactggatgggaccttccagaggaagccatttggggccatcctgaacctggtgccgctggccgagagcgtggtgaagctgacggcggtgtgcatggagtgcttccgggaagccgcctataccaagaggctcggcacagagaaggaggtcgaggtgattgggggagcagacaagtaccactccgtgtgtcggctctgctacttcaagaaggcctcaggccagcctgccgggccggacaacaaagagaactgcccagtgccaggaaagccaggggaagccgtggctgccaggaagctctttgccccacagcagattctgcaatgcagccctgccaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Ras-related GTP binding D
- chymotrypsin C (caldecrin)
- methyltransferase like 1
- PIH1 domain containing 1

Buy TK1-thymidine kinase 1, soluble Gene now

Add to cart