Login to display prices
Login to display prices
TMED5-transmembrane emp24 protein transport domain containing 5 Gene View larger

TMED5-transmembrane emp24 protein transport domain containing 5 Gene

PTXBC016365

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMED5-transmembrane emp24 protein transport domain containing 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMED5-transmembrane emp24 protein transport domain containing 5 Gene

Proteogenix catalog: PTXBC016365
Ncbi symbol: TMED5
Product name: TMED5-transmembrane emp24 protein transport domain containing 5 Gene
Size: 2ug
Accessions: BC016365
Gene id: 50999
Gene description: transmembrane emp24 protein transport domain containing 5
Synonyms: CGI-100; p24g2; p28; transmembrane emp24 domain-containing protein 5; p24 family protein gamma-2; p24gamma2; transmembrane emp24 protein transport domain containing 5; transmembrane p24 trafficking protein 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcgacaagatctggctgcccttccccgtgctccttctggccgctctgcctccggtgctgctgcctggggcggccggcttcacaccttccctcgatagcgacttcacctttacccttcccgccggccagaaggagtgcttctaccagcccatgcccctgaaggcctcgctggagatcgagtaccaagttttagatggagcaggattagatattgatttccatcttgcctctccagaaggcaaaaccttagtttttgaacaaagaaaatcagatggagttcacactgtagagactgaagttggtgattacatgttctgctttgacaatacattcagcaccatttctgagaaggtgattttctttgaattaatcctggataatatgggagaacaggcacaagaacaagaagattggaagaaatatattactggcacagatatattggatatgaaactggaagacatcctggaatccatcaacagcatcaagtccagactaagcaaaagtgggcacatacaaactctgcttagagcatttgaagctcgtgatcgaaacatacaagaaagcaactttgatagagtcaatttctggtctatggttaatttagtggtcatggtggtggtgtcagccattcaagtttatatgctgaagagtctgtttgaagataagaggaaaagtagaacttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: