Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TMED5-transmembrane emp24 protein transport domain containing 5 Gene
PTXBC016365
New product
Data sheet of TMED5-transmembrane emp24 protein transport domain containing 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMED5-transmembrane emp24 protein transport domain containing 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016365 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMED5 |
| Origin species: | Human |
| Product name: | TMED5-transmembrane emp24 protein transport domain containing 5 Gene |
| Size: | 2ug |
| Accessions: | BC016365 |
| Gene id: | 50999 |
| Gene description: | transmembrane emp24 protein transport domain containing 5 |
| Synonyms: | CGI-100; p24g2; p28; transmembrane emp24 domain-containing protein 5; p24 family protein gamma-2; p24gamma2; transmembrane emp24 protein transport domain containing 5; transmembrane p24 trafficking protein 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcgacaagatctggctgcccttccccgtgctccttctggccgctctgcctccggtgctgctgcctggggcggccggcttcacaccttccctcgatagcgacttcacctttacccttcccgccggccagaaggagtgcttctaccagcccatgcccctgaaggcctcgctggagatcgagtaccaagttttagatggagcaggattagatattgatttccatcttgcctctccagaaggcaaaaccttagtttttgaacaaagaaaatcagatggagttcacactgtagagactgaagttggtgattacatgttctgctttgacaatacattcagcaccatttctgagaaggtgattttctttgaattaatcctggataatatgggagaacaggcacaagaacaagaagattggaagaaatatattactggcacagatatattggatatgaaactggaagacatcctggaatccatcaacagcatcaagtccagactaagcaaaagtgggcacatacaaactctgcttagagcatttgaagctcgtgatcgaaacatacaagaaagcaactttgatagagtcaatttctggtctatggttaatttagtggtcatggtggtggtgtcagccattcaagtttatatgctgaagagtctgtttgaagataagaggaaaagtagaacttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nicotinate phosphoribosyltransferase domain containing 1 - RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) - coagulation factor C homolog, cochlin (Limulus polyphemus) - polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa |